ID: 1151953702

View in Genome Browser
Species Human (GRCh38)
Location 17:77370000-77370022
Sequence CTGTCCCAAGGGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 1, 2: 5, 3: 52, 4: 394}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151953702_1151953715 9 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953715 17:77370032-77370054 GGACGGGTGGGCTACCCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1151953702_1151953712 -4 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953712 17:77370019-77370041 ACAGTGATCTGCTGGACGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1151953702_1151953713 -3 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953713 17:77370020-77370042 CAGTGATCTGCTGGACGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1151953702_1151953711 -7 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953711 17:77370016-77370038 GGGACAGTGATCTGCTGGACGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1151953702_1151953710 -8 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953710 17:77370015-77370037 TGGGACAGTGATCTGCTGGACGG 0: 1
1: 0
2: 0
3: 13
4: 177
1151953702_1151953714 8 Left 1151953702 17:77370000-77370022 CCATCCCCCTTCCCTTGGGACAG 0: 1
1: 1
2: 5
3: 52
4: 394
Right 1151953714 17:77370031-77370053 TGGACGGGTGGGCTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151953702 Original CRISPR CTGTCCCAAGGGAAGGGGGA TGG (reversed) Intronic
900637751 1:3674275-3674297 GTGGCCCACGGGAAGCGGGAGGG - Intronic
901090068 1:6635032-6635054 CTGTCCCAAGCCGAGGGGGCCGG + Exonic
901135116 1:6988013-6988035 ATGTTCCCAGGGAAGAGGGATGG - Intronic
901182268 1:7349952-7349974 CTGGCAGAAGGGAAGAGGGATGG + Intronic
901551187 1:9997322-9997344 CTGGCCCTAGGTAAGGCGGAGGG + Exonic
901807116 1:11745566-11745588 CTGCCCCATGGGAGGGGTGAAGG + Intronic
901907028 1:12421825-12421847 CTGTCTCAAAAAAAGGGGGATGG - Intronic
902374562 1:16024210-16024232 CTGCCCCAAGGCACGGAGGAGGG - Intronic
902450668 1:16494870-16494892 CAGTCCTAAGGGTTGGGGGAAGG + Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903674931 1:25057610-25057632 CTGTCCTTAGGGAGAGGGGAGGG - Intergenic
903867910 1:26411833-26411855 CTTTCCCCTGGGAAGGGGCAGGG + Intronic
903935683 1:26893272-26893294 CTACCCCAAGGGAACGGGAACGG + Intronic
906676140 1:47694770-47694792 CTGTCCCAGGGGAGTGGGGCTGG - Intergenic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
911811245 1:102284716-102284738 CTGTCCCCAAGGGAGTGGGAAGG + Intergenic
911965213 1:104360166-104360188 CTTTCCTAAGGAAAAGGGGAAGG + Intergenic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912430037 1:109624149-109624171 CTGGACAAAGGGAAGAGGGAGGG - Intronic
912831156 1:112955605-112955627 CTGCCCCAAGGGAAGGGACTCGG - Exonic
912858421 1:113192100-113192122 CAGGCCCAAGTGAAAGGGGAGGG + Intergenic
913168286 1:116209503-116209525 CTGCCCCAGAGAAAGGGGGAAGG - Intergenic
914737612 1:150432971-150432993 CTGTCTCAAGGTGAGGGGGTTGG + Intronic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
915947278 1:160162697-160162719 ATGTCCCCAGGGAAGGGGGTTGG + Intronic
916260254 1:162834684-162834706 GTGTCCCAAGGGATGGGCCAGGG + Intronic
916930029 1:169567233-169567255 ATCTCCCAAAGGAGGGGGGAGGG + Intronic
917137403 1:171800858-171800880 ATGTCACAAGGTAAGGAGGAAGG + Intronic
917410601 1:174756624-174756646 CTGTCCCCAGGGAAGTAGCAGGG + Intronic
917630772 1:176889247-176889269 CTATCCCAAGGGGAGGGAGAGGG + Intronic
917668812 1:177251952-177251974 CTATCCCAAAGCAAGGGGGCTGG + Intronic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
921553983 1:216574914-216574936 CTTTCCCAAGGGAAGGAGGGAGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
922555341 1:226528221-226528243 CTGTACCAAGGGATGGGGTCGGG + Intergenic
922797355 1:228347017-228347039 CTCCCCCAAGGGAAGGCAGAGGG - Intronic
923844421 1:237713031-237713053 CTGTCACAAGGGAAGTAGAATGG + Intronic
1063401653 10:5752094-5752116 CTGCTGCAAGGGTAGGGGGAGGG - Intronic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1066202437 10:33154783-33154805 AAATCCCAAGGGAATGGGGAGGG + Intergenic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1067171135 10:43906858-43906880 CCGACCCAAGGGAAGGGGCAGGG - Intergenic
1067437249 10:46287011-46287033 CTGTCCCCAGGGTGGGGGAAGGG + Exonic
1067972637 10:50990880-50990902 TGGTACCAAGGGAAGGGGGTGGG - Intergenic
1068475963 10:57525610-57525632 TTGTTCCAAGAGAAGGGGAAGGG - Intergenic
1069551377 10:69366810-69366832 CTCTCACAAGGGAAGGGGAAGGG - Intronic
1069693379 10:70369282-70369304 CTGCCCCGAGGGATGGGGGTGGG - Intronic
1069836429 10:71311313-71311335 CTCTCTCCAGGGAAGTGGGAGGG + Intergenic
1070151534 10:73808227-73808249 GTCTCCCAAGGGCAGGGGCAAGG + Exonic
1070591738 10:77806671-77806693 CTGTCCCATGGGAGGGGGCTGGG - Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1071483724 10:86083944-86083966 GTGTCCCAAGGGAAGGGGCGAGG + Intronic
1071528676 10:86373117-86373139 CTCTCCCAAGGGATCAGGGATGG + Intergenic
1071752619 10:88497786-88497808 CTGTCCAAAGGGAAGGTGTGAGG + Intronic
1072674234 10:97453719-97453741 CTGTCCCTAAGGAATGGGGCTGG + Intronic
1073077129 10:100831106-100831128 CTGTCCCAAGCCAAAGGGGAAGG - Intergenic
1073356461 10:102858873-102858895 CTGACCCAAGAGAACAGGGAAGG + Intronic
1073543165 10:104328536-104328558 CTGACTCAATGGAAAGGGGAAGG + Intronic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1075200002 10:120394704-120394726 TCCTCACAAGGGAAGGGGGAAGG + Intergenic
1076816129 10:132915527-132915549 CTGCCCCAAGGGACCGGCGAGGG + Intronic
1076902700 10:133347724-133347746 CTGCCCAAAAGGAAGGGGGCTGG + Intronic
1077239151 11:1501637-1501659 CTGTGCCAAGGGAAGGGACTGGG + Intergenic
1078126926 11:8575037-8575059 CTGTCTCAAAAAAAGGGGGAAGG + Intronic
1078320051 11:10326484-10326506 CTATACCATAGGAAGGGGGAAGG - Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1080429593 11:32185942-32185964 CTGGCCCAAGGGAAGTGGGAAGG - Intergenic
1080636392 11:34127530-34127552 CTTCACCAAGGGGAGGGGGATGG - Exonic
1081652780 11:44835487-44835509 CTGCTCCCAGGGAAGGAGGAAGG + Intronic
1081747038 11:45480690-45480712 CTGTCCCCAGGGAAGGTGGTGGG + Intergenic
1081957692 11:47107856-47107878 CTGCCCCAAGGGAACTGGGGGGG - Intronic
1082667604 11:55992932-55992954 CTGTCTCAAGGAAAGAGGGAGGG + Intergenic
1083042599 11:59702107-59702129 CTGTCCGAGGGGGAAGGGGAGGG - Intergenic
1083089330 11:60184022-60184044 CTCCCCCAAGGAAAGGAGGAAGG - Intronic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084418743 11:69049654-69049676 CAGCCCCACGGGAAGTGGGACGG - Intronic
1084564499 11:69921436-69921458 GTGTCCCAAGAGAAGGAGGAGGG + Intergenic
1084967037 11:72750311-72750333 CTGTTCCCAGGGTAGGGGGAGGG - Intronic
1087734543 11:101817164-101817186 GTGTGCCCAGGAAAGGGGGAAGG + Intronic
1088661583 11:112052759-112052781 CTGACCTAAGGGAAAGGGGAGGG - Intronic
1088750962 11:112841797-112841819 CTGTCACCAGGGGAGGGGGGTGG + Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089294412 11:117459241-117459263 CTCTCCCATGGGAAGGGAGTTGG - Intronic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090664366 11:128905201-128905223 CTGTCCCCAGGGAACGGGCGTGG - Intronic
1091718191 12:2794741-2794763 GGGTCCCAGGAGAAGGGGGAGGG + Intergenic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1092120787 12:6042313-6042335 CTGTCCCTTGTGAAGGGGCAGGG - Intronic
1092629536 12:10363279-10363301 CCTTCCCTAGGGAAAGGGGAAGG + Intergenic
1092643657 12:10545518-10545540 CTTTCCCAAGGCAAGGGTGAAGG - Intergenic
1093160514 12:15741288-15741310 CTGTCCCTAGTGGAGGGGGGTGG - Intronic
1093247045 12:16752017-16752039 CTGTCAAGAGGGAAGAGGGATGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1096653801 12:53075848-53075870 CTAGCCCAAGAGTAGGGGGAGGG + Intronic
1097487475 12:60223427-60223449 CTGTCCCAAAGGGAGGGTAAGGG + Intergenic
1098550846 12:71759521-71759543 CTTACTCAAGGGAAGGAGGAGGG - Intronic
1099033606 12:77559549-77559571 GTGCCCCATGGGGAGGGGGATGG + Intergenic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1102453436 12:113057292-113057314 CTGCCCCAAGGGAAAGCGGGCGG + Intronic
1102807046 12:115791364-115791386 CGGTCCCAAGTGGAGGGCGATGG - Intergenic
1103835910 12:123820885-123820907 TTGGCCGCAGGGAAGGGGGATGG + Intronic
1103993007 12:124811823-124811845 CTGTCGCCAGGGAGAGGGGAGGG - Intronic
1104178703 12:126357353-126357375 ATGTACCAAGGGAAGAGGGGGGG + Intergenic
1105840758 13:24251947-24251969 CTGGCCCAAGGGAGGCGCGAAGG - Intronic
1106074452 13:26445754-26445776 CTGTCCCAAGGGAAGACGTACGG - Intergenic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108273177 13:48783091-48783113 CATTCCTAGGGGAAGGGGGAGGG - Intergenic
1111531283 13:89541102-89541124 CTGCCCCTATGGAATGGGGAAGG - Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1116798600 14:49418332-49418354 CCTTCCCAGGGGAAGGGGGTTGG + Intergenic
1117153952 14:52919030-52919052 TTATCCCAAGGGATGGGGCATGG - Intronic
1118502862 14:66379453-66379475 CTGCCCCAAGGGTAGGGTGGTGG - Intergenic
1118756045 14:68844357-68844379 CTGTCCCAAAAGAAGAGGGGTGG - Intergenic
1119050289 14:71361081-71361103 ATATCCCTAGTGAAGGGGGAAGG - Intronic
1119391149 14:74291968-74291990 ATGCCCCAAGGAAAGGGGCAGGG + Intronic
1119620249 14:76126463-76126485 CCATCCCAAGGGAAGAGGGCAGG + Intergenic
1119642453 14:76325424-76325446 CTGCCTCAAGGGAAAGGAGACGG + Intronic
1121119407 14:91366737-91366759 CTGTAACCAGTGAAGGGGGACGG + Intronic
1122308638 14:100780932-100780954 ATCTCCCAAGGGGAGGGGGCAGG - Intergenic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122875152 14:104660487-104660509 CTTTCCCAAGTGCAGGGGGGTGG - Intergenic
1123107069 14:105846603-105846625 CTGCCCCAAGGGAGAAGGGAAGG - Intergenic
1123449098 15:20349326-20349348 GAGTCCCAGGGGGAGGGGGAGGG - Intergenic
1124652153 15:31482305-31482327 CTTTCCAAAGGGAAGGGGCTGGG - Exonic
1125361976 15:38873900-38873922 CTGTCCCCCGGGAAGAGTGAGGG - Intergenic
1125685486 15:41560939-41560961 CTGGGCGAAGGGAAGGGGCATGG - Intronic
1125706202 15:41738737-41738759 CAGTCCCAAGGGATCCGGGAGGG + Intronic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128499515 15:68218133-68218155 CTATCCCAAGGTAATGGGGAAGG + Intronic
1129076081 15:72997229-72997251 ATGTCCCAAGGGAGGGGAGATGG + Intergenic
1129264602 15:74387054-74387076 CTGTCACGAGTGAAGGGGGTTGG - Intergenic
1129289108 15:74549771-74549793 ATGTCCCCTGGGAAGGGGCAGGG - Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1130705834 15:86232244-86232266 CCGTCCCAAGGGGACAGGGATGG - Intronic
1130854622 15:87830416-87830438 CTGTCCCGAAGGGAGGGGAAGGG + Intergenic
1131180069 15:90233584-90233606 CTGTCCCGAGGGAGGGGCGGGGG - Intronic
1133032487 16:3017932-3017954 TTGTCCCTGGGGAGGGGGGAGGG + Intronic
1133233236 16:4376206-4376228 GTGTCCCAAGGAAGGGGAGACGG + Intronic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136396406 16:29994889-29994911 CTATCCGAAGTGAAGGGAGAAGG - Intronic
1136483798 16:30558275-30558297 CGGGCCCAAGGGAAGGAGGGAGG + Exonic
1136616116 16:31399552-31399574 GGGGACCAAGGGAAGGGGGAAGG + Intronic
1137432170 16:48427230-48427252 CAGTCCCAGGGGCAGGGGCAGGG + Intronic
1137573041 16:49579111-49579133 CTTCTCCAAGGGAAAGGGGAGGG + Intronic
1138104221 16:54278827-54278849 ATGTCCCCAGGGAGGGGGCAAGG + Intergenic
1138110565 16:54320534-54320556 CTGTCCCCAGAGAAGATGGAAGG + Intergenic
1138358534 16:56405988-56406010 CTGTCAGAAGGGAAGGGGAAGGG + Intronic
1138597860 16:58038662-58038684 CTGCAGCAAGGGATGGGGGATGG + Intronic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1140416692 16:74778682-74778704 CAGTCCGAAGAGAAGGGAGAGGG - Intergenic
1141046111 16:80717449-80717471 CTGCCACCAGGGAAGGTGGATGG + Intronic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142065621 16:88060750-88060772 GTGTCCCCAGGAAAGGGAGAAGG - Intronic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1143151153 17:4808124-4808146 CTGGCCCCAGGGAGGGGGAAAGG + Intronic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143816511 17:9519901-9519923 TTGATTCAAGGGAAGGGGGATGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144887268 17:18471800-18471822 CTGTCCCTAGGGAGTGAGGAGGG - Intergenic
1145144948 17:20472495-20472517 CTGTCCCTAGGGAGTGAGGAGGG + Intergenic
1145929661 17:28676056-28676078 TTGTCCCAAGGGAACTGAGAGGG - Intronic
1146931748 17:36782794-36782816 CAGTCCCAAGGGAGAGGGGGAGG - Intergenic
1147310523 17:39593420-39593442 CTGTGTCCAGGGAAGGGGCAGGG + Intergenic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147614256 17:41819193-41819215 CTGTCCCTGGGGAAGGGATAGGG - Exonic
1147629297 17:41919366-41919388 TTCTCCCAAGGGAAGGAGCAAGG - Intronic
1148542778 17:48493331-48493353 CTCTCCCATGGGAAAGGGCATGG - Intergenic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148653774 17:49268243-49268265 CAGACCCTAGGGAAGGGTGAAGG - Intergenic
1148678095 17:49456751-49456773 CCCTCCCATGGGAAGGGAGAAGG - Intronic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150211096 17:63441915-63441937 CTGACCGAAGGCAAGAGGGAAGG + Intronic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150584522 17:66505321-66505343 CTGGCCACAGGGAAGAGGGAGGG + Intronic
1151538040 17:74749574-74749596 CAGACCCGAGGGAAGGGGGCTGG - Intronic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1151593281 17:75061121-75061143 CTGTCCCGTGGGAAGACGGAGGG + Intronic
1151767366 17:76139345-76139367 GTGTCCCAATGGAGGGTGGAGGG - Intronic
1151939287 17:77282537-77282559 ATGGCCCAAAGGCAGGGGGATGG - Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152339547 17:79716538-79716560 GAGTCCCAAGGGGAGGGGGAGGG + Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153424210 18:4944946-4944968 CTAGCCCAAGGGCAGGGGCAGGG - Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154191707 18:12235751-12235773 CTTTCACATGGGAAAGGGGAGGG + Intergenic
1154325841 18:13389772-13389794 CTGCCCCAAAGGAAAGGGAAAGG + Intronic
1154388185 18:13914242-13914264 GTGTCCCAAAGGCAGGGTGAGGG + Intronic
1154411776 18:14145642-14145664 CTGCCCCCAGGGCAGGGGTAAGG + Intergenic
1155280564 18:24235401-24235423 CTTTCCCAAGAGTAGGGGAATGG + Intronic
1155522742 18:26685547-26685569 CTGTCCCCAGGGAAGGCCAAGGG + Intergenic
1156442125 18:37201004-37201026 CCATCCCAAGTCAAGGGGGAAGG + Intronic
1157574450 18:48734166-48734188 TTGTCCCAGGGGAAGTGGGTGGG - Intronic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1161164443 19:2778561-2778583 CTGTCCCAGGGTAACAGGGATGG - Intronic
1161697217 19:5776114-5776136 CTGGCCCTAGGGACTGGGGAGGG - Intronic
1161807322 19:6452230-6452252 CAGCCCCAGGGGAAGGGGAAGGG + Intronic
1162552329 19:11364625-11364647 TTGTCCCGGTGGAAGGGGGAGGG - Exonic
1162808905 19:13152787-13152809 TTGGCCCAAGGGAGGGGGGCCGG - Exonic
1162930610 19:13955761-13955783 CTGTCCTCAGGCAAGGTGGAGGG + Intronic
1162989497 19:14293280-14293302 CCGCCCTAAGGGAAGGGGGGGGG - Intergenic
1163018325 19:14470153-14470175 CTGTCCCCAGGGATGGGCTATGG + Exonic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1163102872 19:15108315-15108337 ATGTTCCCAGGGAAGGGAGAAGG + Intronic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163844101 19:19628774-19628796 CTGTCCCAGGGTGAGGGGTACGG - Exonic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1166531753 19:43547006-43547028 CAGGCCCAAGGGAAGTGGGGAGG + Intronic
1166688590 19:44809994-44810016 CTGTCCCCAGGGAGGGGTGACGG - Intronic
1167576533 19:50320472-50320494 TGGGGCCAAGGGAAGGGGGAAGG + Intronic
1167600267 19:50450947-50450969 CAGCCCCCAGGGAAGGAGGAAGG - Intronic
1168240993 19:55088821-55088843 CTGCCCCAAGGGCGGGGGGCGGG - Intergenic
1168313787 19:55474918-55474940 ATGGCCCGAGGCAAGGGGGACGG + Intergenic
1168406465 19:56112950-56112972 AAGCCCCAAGGGAAGGGGAATGG - Intronic
925161137 2:1685230-1685252 CTGTCCCGGGGCAAGGGGCAGGG - Intronic
925734322 2:6948027-6948049 AGGTCCCGAGGGAAGAGGGAAGG + Intronic
925924266 2:8659188-8659210 CTGCCCCAGGGGCAGGGGCAGGG + Intergenic
927619165 2:24634200-24634222 CTCTATCAAGGGGAGGGGGAAGG + Intronic
929073571 2:38058534-38058556 TTGTCCCAAGGCAAAGGTGAAGG + Intronic
929116546 2:38449241-38449263 GTGTTCCCAGGGAAGAGGGAAGG - Intergenic
929819873 2:45264400-45264422 CAGTTCCAAAGGAAGGGGGTTGG + Intergenic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932358347 2:71085415-71085437 CTGTCCCCTGGGACTGGGGAAGG + Intergenic
932370592 2:71184299-71184321 CTGTCCCCTGGGACTGGGGAAGG + Exonic
933495016 2:83039641-83039663 AAGTCCCATGGAAAGGGGGAAGG - Intergenic
934573877 2:95388549-95388571 CTGTCCTCAGGGCAGGGTGAGGG - Intergenic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
935618524 2:105109381-105109403 CTGTCCCAAGGGGAAAGTGAAGG + Intergenic
936000133 2:108819322-108819344 CTGTCCCAAGGGAGACGGTAGGG - Intronic
936059354 2:109284161-109284183 CGGTCCCAGGGGAAGGGGGTTGG + Intronic
939317866 2:140576313-140576335 CTTTCCCAAAGGAAGTAGGAAGG - Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
940152531 2:150617970-150617992 CTGTCCCTTAGGAAGGGGCAGGG - Intergenic
943541098 2:189215266-189215288 CAGTCCCAAGGAAACTGGGATGG + Intergenic
943562397 2:189479330-189479352 CTCTCCTAAAGGAAGAGGGAGGG - Intergenic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
944659298 2:201907519-201907541 ATGTCTCAAGGGTAGGGGGTGGG + Intergenic
945706702 2:213243571-213243593 ATGTGCCAAGGCAAGGGGAAGGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
947455562 2:230250718-230250740 ATGTGCCTAGGAAAGGGGGAGGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947856680 2:233328841-233328863 CTGTCCCGAGGGACTGGGGAAGG + Intronic
947864450 2:233386539-233386561 CTGTCTCTAGGGGAGGGGGTGGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948609217 2:239156109-239156131 CTGTCCTAAGCCAAGGGAGAAGG - Intronic
948660432 2:239503346-239503368 CTGCCCCAAAGGGAGAGGGAAGG + Intergenic
948678421 2:239612561-239612583 CTGACCCCAGGAAAGGGAGAAGG - Intergenic
948768738 2:240236559-240236581 CTGTCCCCAGGGATCTGGGATGG - Intergenic
948852785 2:240716569-240716591 CTTTCCCCAGGAAAGGGTGAGGG - Exonic
1169201714 20:3713485-3713507 CTGTCCCAAGGTGGGGGTGAAGG - Intergenic
1169227317 20:3864817-3864839 CTGTCCCGGGGGAAGGGGCCAGG - Intronic
1169349260 20:4855003-4855025 GTGTCCCAAGGCAAGAGGGATGG + Exonic
1169560079 20:6790395-6790417 AAGTCTCAAGGGAAGTGGGAAGG + Intergenic
1170370341 20:15640972-15640994 CTGGCCCAAGGAAATGAGGAAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171400924 20:24872661-24872683 CATCCCCAGGGGAAGGGGGAGGG + Intergenic
1172235843 20:33373570-33373592 CTGTCCCAAGGCAAGCTGTATGG - Intronic
1172604681 20:36206648-36206670 CTTCCCCAAAGGAAGGGGCAGGG + Intronic
1173842007 20:46163672-46163694 ATTTCCCAGGGGAAGGGGGGGGG - Intergenic
1174582101 20:51579378-51579400 CTGGGCCCAGGGAAAGGGGAAGG + Intergenic
1175009037 20:55716102-55716124 CTCTGCCAAGGCAAGTGGGAGGG + Intergenic
1178668252 21:34567441-34567463 CTGGCCTAAGGGAAAGGGGCAGG + Intronic
1178846897 21:36181636-36181658 CTGTCCCACAGGAAAAGGGAAGG + Intronic
1178981338 21:37267568-37267590 CTGTCCCTACGGAAGGGGTGGGG - Intronic
1179809230 21:43859605-43859627 CTGACCCCTGGGATGGGGGATGG + Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1181168355 22:20995037-20995059 CAGCCCCCAGGGAAGGGGAACGG - Intronic
1181173263 22:21022070-21022092 CTGTCAGGAGGGAAGGGGCAGGG + Intronic
1181370405 22:22410503-22410525 GTGTCCCAAGTTAAGGGAGAGGG - Intergenic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1182276905 22:29195534-29195556 CTGTCAGGAGGGAAAGGGGACGG + Intergenic
1182278816 22:29206436-29206458 CTTTCCCAAGTGCAGGGGGAGGG - Intronic
1182292615 22:29293054-29293076 CTGTCCCTAGGGGTGGAGGAGGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1184522845 22:45006030-45006052 CTCTCCCAAGGAGAGGGAGAGGG + Intronic
949294629 3:2507182-2507204 CTGGCCCAAGGGAAGCATGATGG - Intronic
949890868 3:8733035-8733057 CTGTCACTAGGGCAGGGTGAAGG + Intronic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950648303 3:14391628-14391650 CTGGCCCACGGGAAGGAGCAGGG + Intergenic
950887515 3:16374427-16374449 CTATCCCAAGGGAGTTGGGAGGG + Intronic
952512722 3:34073192-34073214 CTGTGCCAAGGCAAAAGGGATGG + Intergenic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
953327567 3:42025535-42025557 CTGTTCAAAGGGAGAGGGGAAGG + Intronic
954370332 3:50166717-50166739 CTGGGCCCAGGGGAGGGGGAGGG + Intronic
954792070 3:53140952-53140974 TGGCCCCAAGGGAAGGGAGAAGG + Intergenic
954796514 3:53164034-53164056 CTGCCCCCAGGGAATGGTGATGG + Intronic
955043381 3:55337583-55337605 CCTTCCCAAGGGAACAGGGATGG + Intergenic
955887821 3:63619280-63619302 CTGTCCCCAGGAATGGGGGAGGG - Intergenic
956142366 3:66158937-66158959 CTGTCCCACAGTATGGGGGAAGG - Intronic
956738701 3:72258641-72258663 CAGACCCAAAGGAAGGAGGAGGG + Intergenic
956791430 3:72683133-72683155 ATCTCCCCAGGGAAGGAGGAGGG - Intergenic
957193357 3:77039103-77039125 CATCCCCAAGGGAAGGAGGAAGG - Intronic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
961344700 3:126256476-126256498 CAGTGCCACGGGTAGGGGGAGGG + Intergenic
961424275 3:126832762-126832784 CTGACCCAGAGAAAGGGGGAGGG + Intronic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
961791606 3:129380605-129380627 CTGTCCCCAGGGCAGGGAGCAGG + Intergenic
963107754 3:141660752-141660774 CTGTCCCGAGGGGATGTGGAGGG - Intergenic
963729313 3:148956232-148956254 CTGTCCCCAAAGAAGGGTGAAGG - Intergenic
965145126 3:164890875-164890897 CACTGCCAAGGGATGGGGGAGGG + Intergenic
965901500 3:173645974-173645996 CTGTCACAAGGAAAAGGGGGAGG - Intronic
966881998 3:184355709-184355731 CTGTCCAAAGCCAGGGGGGAAGG + Exonic
967078257 3:186024811-186024833 ATGGCCCGAGGGAAGGAGGATGG + Intergenic
967478390 3:189946732-189946754 CGGTCCCAGGGAAAGTGGGATGG + Intergenic
968510265 4:992463-992485 CTGTCCCAAGTCCAGGCGGATGG - Intronic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
969121324 4:4913492-4913514 CAGGCCCTGGGGAAGGGGGAGGG + Intergenic
969489501 4:7491056-7491078 ATGTCCCAAGGGAAGGCAAAGGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969613839 4:8241162-8241184 CTGCCCCCAGGGAAGGGAGCTGG - Intronic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
974416366 4:61612309-61612331 CTGTCACAAGTGAAGAGAGAAGG - Intronic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
979542791 4:121905273-121905295 CTGGGCCAAGGGTAGGGAGAAGG + Intronic
981011935 4:139933852-139933874 GCGTCCCAAAGGAAGAGGGATGG + Intronic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
982846045 4:160253787-160253809 GTGACCCAAGGGAAAGAGGATGG - Intergenic
984133343 4:175905536-175905558 CTGGCACAAGAGAAGGGAGAAGG + Intronic
984258321 4:177413558-177413580 GAATCTCAAGGGAAGGGGGAAGG + Intergenic
985531883 5:438657-438679 CAAGCCCATGGGAAGGGGGAAGG + Intergenic
985781758 5:1875379-1875401 GTGCCCCAAGGGAAGGGTGTGGG + Intergenic
985783238 5:1881620-1881642 CTGTCCCAGGGGGTGGGGGTGGG + Intronic
986723646 5:10578238-10578260 CTGTCCCCAGGAAACTGGGATGG + Intronic
986798540 5:11235772-11235794 CAGTCCCAGGGGAAGAGAGATGG + Intronic
987155187 5:15082054-15082076 TTGTCCCAAGTGAGTGGGGAGGG - Intergenic
988069284 5:26266470-26266492 CACTCCCTAGGGAAGGGGTAAGG - Intergenic
989663631 5:43825349-43825371 CCGTGCAAAGGGTAGGGGGAGGG + Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994106880 5:95959439-95959461 CTGTTCCAAGGGAAGGGCGTGGG - Intronic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996616400 5:125446420-125446442 CTGTGCCAAGGGTAGGAGCAGGG + Intergenic
997100513 5:130963429-130963451 CAGTCCAAAGGGAAGAGAGATGG + Intergenic
997384226 5:133459852-133459874 CTTTGCCTAGGGAAAGGGGAGGG - Intronic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
998393705 5:141804690-141804712 CTCTCCCAAGGCAGCGGGGAAGG + Intergenic
999288189 5:150406802-150406824 CAGTGCCAAGGGGAGGGGCAGGG - Intronic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001219597 5:169888848-169888870 CTATCCCAAGGGAAAGAGGAGGG - Intronic
1002012905 5:176298249-176298271 CTGGCCCAAGGGAAGAGCCAAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002214936 5:177624486-177624508 CTGGCCCAAGGGAAGAGCCAAGG + Intergenic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1005386848 6:25293728-25293750 CTGTCAAAAGGGAAGAGGAAGGG - Intronic
1005888260 6:30113831-30113853 CTATACCAAGAGAAGGGGTAGGG - Intergenic
1005928780 6:30465501-30465523 CTGCCCAAAGGGAATGGGAAGGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006358979 6:33577088-33577110 CTATCCCCTGGGAAGAGGGAAGG + Intronic
1006422095 6:33941359-33941381 CATTCTCAAGGGAAGGAGGAAGG - Intergenic
1007378008 6:41469466-41469488 CTGTCTCTAGGAAAGGGGGTGGG + Intergenic
1007812418 6:44495813-44495835 CTGTCCCAAGGTGAGCGAGATGG + Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1011511759 6:88108982-88109004 TTGTCCCAACTGAAGGGTGAGGG - Intergenic
1013612158 6:111805689-111805711 TTCAACCAAGGGAAGGGGGAGGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1016885938 6:148959768-148959790 CTGTCCCAAGGCAGGAGAGATGG - Intronic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1019819596 7:3232414-3232436 TTGTCCCAAGGGACAGGGGTAGG + Intergenic
1024512366 7:50213814-50213836 CTGACCCCAGGGCAGTGGGAGGG + Intergenic
1024542776 7:50492597-50492619 CTGCCACAAGAGAAGGGTGATGG - Intronic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1026919426 7:74144377-74144399 CTGTCTCAAAGAAAGGGGAAGGG - Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029439126 7:100577623-100577645 CTCTCCCAAGGGAGGGGAGCTGG - Intronic
1029666602 7:101999051-101999073 CTGTCCCCAGGCAAGCAGGAGGG + Intronic
1030059446 7:105611200-105611222 CAGTCCCAGAGGAAGGGGAAGGG - Intronic
1031627752 7:124009802-124009824 CTGGCCCATGGGAAGGAAGAGGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032738031 7:134710835-134710857 CAGTCTCAATGGGAGGGGGAAGG + Intergenic
1033261214 7:139845433-139845455 CTCACCCAAATGAAGGGGGAAGG - Intronic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034859586 7:154583975-154583997 ATATCCCAAAGGCAGGGGGATGG - Intronic
1035053600 7:156018829-156018851 CTATACCAAAGGCAGGGGGAAGG + Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035640990 8:1185015-1185037 CTGACCCGGGGGACGGGGGATGG + Intergenic
1035811469 8:2495190-2495212 CTGCCCAAAGGGAAGGACGAGGG - Intergenic
1035856016 8:2977257-2977279 CTGTCAGTAGGGTAGGGGGAGGG - Intronic
1037860064 8:22398776-22398798 CTGGACCAAGTGAAGGGTGACGG + Intronic
1038005212 8:23424166-23424188 CTGGCCCCAGGGATGGGGGCAGG - Intronic
1038438911 8:27558262-27558284 CTGTCCCTGAGGAAGGGGCAGGG - Intergenic
1039486754 8:37916189-37916211 CTGGCCCCAGGGAGGAGGGAGGG - Intergenic
1042396430 8:68296373-68296395 CTGCCCCAAGGGAAGGCTCAAGG + Intergenic
1043130066 8:76448600-76448622 TTGTCCCAGGGGATGGGGGGGGG - Intergenic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1046507478 8:115154704-115154726 CTGTCCCAAAGGAAGGGGGCAGG - Intergenic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1047287533 8:123500919-123500941 CTGCCCCAAGAGAAGGGTTACGG - Exonic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048908253 8:139109308-139109330 CTTTCCTCAGGGAAGGGTGAGGG + Intergenic
1049136784 8:140909166-140909188 CTGTTGGAAGGGAAGGGGAAGGG + Intronic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1052871513 9:33511841-33511863 GTGTTCCAAGGGATGGGGCAGGG + Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1056337117 9:85583004-85583026 CTCTCATAAGGGAAAGGGGAAGG + Intronic
1056786549 9:89596759-89596781 CAGTCACAAGGGAAGGGGTCTGG - Intergenic
1057686090 9:97236113-97236135 GTGTTCCAAGGGATGGGGCAGGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060917063 9:127397777-127397799 CCGTCCCGAGGGGAGGGGTAGGG - Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061371431 9:130199815-130199837 CTATTCCCAGGGAAGTGGGAAGG - Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1061498701 9:130990248-130990270 CTGGCCCAAGAGCACGGGGAGGG - Intergenic
1061546617 9:131308325-131308347 CTGGCCCTAGAGAAGGGGCAGGG + Exonic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1061741632 9:132710846-132710868 CTGTCAGAAGGGAAGGGGAAGGG - Intergenic
1062084223 9:134640734-134640756 TTGTTCAAAGGGAATGGGGATGG + Intergenic
1062308005 9:135920459-135920481 CTGCCCCGAGGGATTGGGGATGG - Intergenic
1062389183 9:136327362-136327384 CAGTCCCCGGGGAGGGGGGAGGG - Intergenic
1186575341 X:10759567-10759589 CTCTCCCTAGGGGACGGGGAGGG + Intronic
1187155110 X:16714460-16714482 CTGTGACAAGGAAAGGGAGAAGG + Intergenic
1187398354 X:18937554-18937576 TTGAACCAAGGGAAGGGGGAGGG + Intronic
1187415625 X:19090948-19090970 CTGACCTAAGGGACTGGGGAAGG + Intronic
1187546423 X:20257202-20257224 CTTTCCCAAGTGAAGATGGAAGG - Intronic
1187762546 X:22603561-22603583 CTGTGCCAAGTGAAGGGATAGGG + Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188870508 X:35365341-35365363 CACTCCTAAGGGAAGTGGGAGGG + Intergenic
1195346937 X:103960274-103960296 CTACCCCTAGGGAAGTGGGAAGG + Intronic
1195360505 X:104078567-104078589 CTACCCCTAGGGAAGTGGGAAGG - Intergenic
1196198408 X:112858891-112858913 AGGTTCCAAGGGAAGGGGAATGG - Intergenic
1196820048 X:119694295-119694317 CAGTCCCAAGAGAGAGGGGAGGG - Intergenic
1196867937 X:120086355-120086377 CTGTCCCAAGGGCTGAGGAATGG - Intergenic
1196875165 X:120149926-120149948 CTGTCCCAAGGGCTGAGGAATGG + Intergenic
1197193192 X:123671611-123671633 CTGTCCCAAGGGTAGGGAAGAGG - Intronic
1199550163 X:149052175-149052197 CTGTCCTGAGGGTGGGGGGAGGG + Intergenic
1199601795 X:149545431-149545453 CAGGCCCAAGGGAAGGGGCTGGG - Exonic
1199614663 X:149647359-149647381 CTGTGCCCAGGGGAGGGGGGCGG - Intergenic
1199648583 X:149934052-149934074 CAGGCCCAAGGGAAGGGGCTAGG + Exonic
1199816050 X:151397472-151397494 CTGGCCTCAGGGAAGGGGGCGGG + Intronic
1200060050 X:153480148-153480170 GTGTCCCAAGGGTGGGGGGTAGG - Intronic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic