ID: 1151954213

View in Genome Browser
Species Human (GRCh38)
Location 17:77372699-77372721
Sequence AGGGTGCAGCGGTGGCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 250}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151954204_1151954213 -1 Left 1151954204 17:77372677-77372699 CCTTCTCCAGGGCTCACCCAGGA 0: 1
1: 0
2: 4
3: 40
4: 313
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954192_1151954213 28 Left 1151954192 17:77372648-77372670 CCGCCCTGTGCCCCTTCTCCCGG 0: 1
1: 0
2: 1
3: 49
4: 510
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954196_1151954213 18 Left 1151954196 17:77372658-77372680 CCCCTTCTCCCGGACAGTGCCTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954197_1151954213 17 Left 1151954197 17:77372659-77372681 CCCTTCTCCCGGACAGTGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954207_1151954213 -7 Left 1151954207 17:77372683-77372705 CCAGGGCTCACCCAGGAGGGTGC 0: 1
1: 0
2: 2
3: 30
4: 257
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954200_1151954213 10 Left 1151954200 17:77372666-77372688 CCCGGACAGTGCCTTCTCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 404
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954195_1151954213 24 Left 1151954195 17:77372652-77372674 CCTGTGCCCCTTCTCCCGGACAG 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954194_1151954213 25 Left 1151954194 17:77372651-77372673 CCCTGTGCCCCTTCTCCCGGACA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954198_1151954213 16 Left 1151954198 17:77372660-77372682 CCTTCTCCCGGACAGTGCCTTCT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954191_1151954213 29 Left 1151954191 17:77372647-77372669 CCCGCCCTGTGCCCCTTCTCCCG 0: 1
1: 0
2: 7
3: 78
4: 600
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954190_1151954213 30 Left 1151954190 17:77372646-77372668 CCCCGCCCTGTGCCCCTTCTCCC 0: 1
1: 0
2: 5
3: 73
4: 848
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1151954202_1151954213 9 Left 1151954202 17:77372667-77372689 CCGGACAGTGCCTTCTCCAGGGC 0: 1
1: 0
2: 2
3: 26
4: 249
Right 1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG 0: 1
1: 0
2: 3
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151954213 Original CRISPR AGGGTGCAGCGGTGGCCCCC GGG Intronic
900126454 1:1070923-1070945 AGGCTGCAGCAGGGGCACCCAGG + Intergenic
900349286 1:2227323-2227345 ACGGCGCAGCGGGGGCCGCCGGG + Intergenic
900390347 1:2431191-2431213 AGAGAGCAGCAGGGGCCCCCAGG - Intronic
900420876 1:2555470-2555492 AGGGTCCAGCCCTGGCCCCTGGG - Intergenic
900593414 1:3469680-3469702 AAGGTGCAGCGCAGGCTCCCAGG - Intronic
900986165 1:6073863-6073885 AGGCTGCTGCGCTGGCTCCCGGG - Intronic
901136841 1:7002868-7002890 AGGGAGAAGCTGTGGCCTCCAGG - Intronic
902269593 1:15293960-15293982 AGGCTGCAGTGGTGACGCCCAGG - Intronic
902891510 1:19447692-19447714 AGGGTGCTGCTGTGCCACCCTGG - Intronic
902943146 1:19814806-19814828 AGGCTGCAGATGAGGCCCCCGGG + Exonic
903385126 1:22921081-22921103 AGGGTGCCACAGTGCCCCCCCGG - Intergenic
903453254 1:23469520-23469542 AGGGTTCAGCCTTGTCCCCCAGG + Intronic
903475845 1:23618687-23618709 AGTGTGCAGCGATGGCCCAAGGG - Intronic
903668495 1:25022218-25022240 AGGGTTCAGGGGCGGCCCCAGGG - Intergenic
904237714 1:29125016-29125038 GGGGTGCATCAGTGCCCCCCGGG + Intergenic
904468596 1:30722379-30722401 AGGCTGCCGAGGTGGCCACCAGG - Intronic
904624431 1:31794083-31794105 GGGGTGCAGGGGTGGCAGCCAGG - Intronic
904945532 1:34196304-34196326 AGTGTGCAGCGGAGGACCCAGGG + Intronic
906197153 1:43936335-43936357 AGGCTGCGGCGGCGGCCGCCGGG - Exonic
906769593 1:48472112-48472134 CGGTGGCAGCAGTGGCCCCCAGG + Exonic
910646909 1:89524519-89524541 AGGGGGCAGCGATGGCCACATGG + Intergenic
919977763 1:202623661-202623683 GGGGTGCACCCGTGGGCCCCAGG + Intronic
921167831 1:212519621-212519643 GGGATGCAGCAGTGCCCCCCAGG + Intergenic
922570767 1:226633640-226633662 GAGGTGCCGCGGTGGCCTCCTGG - Exonic
923025134 1:230197857-230197879 AGGGTGCAGAGCTGGCCAACAGG - Intronic
1062835085 10:629995-630017 TGGGTGCAGGTGTGGCCCCCGGG - Intronic
1064900443 10:20290396-20290418 AGGGTGCAGTGGTGGGATCCTGG + Intergenic
1066464425 10:35640394-35640416 GGCGTGCAGCGGTGGCGCGCCGG - Exonic
1067338536 10:45382868-45382890 AGGGTGGAGCGGGTGGCCCCAGG + Intronic
1067685474 10:48464161-48464183 AGGGAGCAGGGGAGGCCCCAGGG - Intronic
1067786511 10:49253471-49253493 AGGGTGCAGGGGTGGCAGACAGG - Intergenic
1069598364 10:69687217-69687239 AAGGTTCAGCGGGGGCCACCAGG - Intronic
1069863220 10:71484058-71484080 AGCGTGCAGCTGTGGTCCCAGGG + Intronic
1070792369 10:79196993-79197015 AGTGTGCAGGTCTGGCCCCCAGG + Intronic
1071299409 10:84245188-84245210 GGGGTGCAGCGGGGGCCCAGTGG + Intronic
1071661307 10:87505295-87505317 TGGGTGCAGCGCTGGCCGACTGG + Exonic
1072654342 10:97319775-97319797 AGGGCGCAGCGCAGGACCCCAGG - Exonic
1073188566 10:101633016-101633038 GGGGTGCAGGTGTGGACCCCTGG + Intronic
1073833842 10:107418180-107418202 AGGAAGCAGCTGTGACCCCCCGG + Intergenic
1074969902 10:118527630-118527652 AGGGTGCTGCAGTGGCCCGCAGG - Intergenic
1074983362 10:118637252-118637274 AGGGAGCAGAGGAGGCCCCTAGG - Intergenic
1075940683 10:126388178-126388200 ATGGTGCAGCGCTCGCCGCCGGG - Exonic
1076064996 10:127441735-127441757 GGGGTGCAGGGGAGGCCCGCAGG - Intronic
1076727601 10:132420774-132420796 AGGAACCAGCTGTGGCCCCCCGG - Intergenic
1076898616 10:133326047-133326069 AGGATGCTGCGGTGGCGCTCGGG + Exonic
1076992863 11:284706-284728 AGGGTCCAGGGGGAGCCCCCAGG - Intronic
1078520885 11:12062041-12062063 AGGATGCAGCTGTGGCACCAGGG - Intergenic
1078594533 11:12674806-12674828 CGGGCGCTGCGGTGGCTCCCTGG + Exonic
1080908077 11:36566802-36566824 AGTGAGCAGCTGTGGCCCCAGGG + Intronic
1083544369 11:63537946-63537968 AGAGAGCAGCAGAGGCCCCCGGG + Intronic
1083551221 11:63591512-63591534 AGGGTGCTGCTGTGGCACCCTGG - Intronic
1084317530 11:68354057-68354079 AAGGGGCTGCAGTGGCCCCCGGG + Intronic
1084478232 11:69400905-69400927 AGAGGGCAGGGGCGGCCCCCAGG - Intergenic
1084574217 11:69978111-69978133 AGGGAGCAGCGTTTGTCCCCAGG - Intergenic
1085534296 11:77208800-77208822 AGAGTGCAGAGGTGCCCACCTGG - Exonic
1087116376 11:94529282-94529304 AGGCTGCATCCCTGGCCCCCTGG - Intergenic
1089289390 11:117428597-117428619 AGGCGGCAGCGGGGGCCCCTGGG + Exonic
1089540677 11:119187612-119187634 AGCGGGCAGGGGTGCCCCCCGGG + Exonic
1090227814 11:125082176-125082198 TGGGTTCAGTGGTGGCCCCAAGG - Intronic
1090933793 11:131324033-131324055 AGAGTGTCGCGGTGGCCTCCTGG + Intergenic
1091205555 11:133818549-133818571 AAGGAGCAGCGGAGGCTCCCGGG - Intergenic
1092282351 12:7108089-7108111 GGGGAGCAGTGGTGGACCCCAGG - Intronic
1096398810 12:51288235-51288257 AGGGCACAGGGATGGCCCCCAGG - Intronic
1097040243 12:56152159-56152181 AGAGTGCAGCGGTTCTCCCCGGG + Intergenic
1101959331 12:109236910-109236932 TGGGTGCAGCGCTGGCTCCTGGG - Intronic
1102022799 12:109695731-109695753 AGGGTGGAACGTTGGACCCCAGG + Intergenic
1103954162 12:124567315-124567337 AGGTGGCAGCGGTGGCGCCCGGG + Intronic
1103988077 12:124780495-124780517 AGGGGGCAGCAGTGGCCTGCAGG + Intronic
1104551900 12:129764913-129764935 AGGGTCTTGCTGTGGCCCCCAGG - Intronic
1104633637 12:130424697-130424719 AGGGTGCAGGGCCGTCCCCCAGG - Intronic
1104713892 12:131004387-131004409 AGGGAGCTGCGGTGCTCCCCCGG + Intronic
1104986571 12:132600858-132600880 TGGGTGCAGCGGGGGCTTCCCGG + Intergenic
1104990012 12:132619629-132619651 AGGGGGCAGCGGCTGCCGCCTGG + Intronic
1105202888 13:18194712-18194734 TGGGGGCAGCGCTGGACCCCAGG + Intergenic
1106463674 13:29994317-29994339 AGGATGCAGCTGTGGGTCCCTGG + Intergenic
1108386909 13:49907339-49907361 AGGGTGCAGCGATGTTGCCCAGG + Intergenic
1111396182 13:87672231-87672253 AGGGTGCAGCGAAGGCTGCCAGG + Intergenic
1113280109 13:108779514-108779536 AGGGTGCAGCTGTGACCACAGGG + Intronic
1114066187 14:19061764-19061786 TGGGGGCAGCGCTGGACCCCAGG + Intergenic
1114096081 14:19338260-19338282 TGGGGGCAGCGCTGGACCCCAGG - Intergenic
1117338397 14:54774172-54774194 AGGGGGCAGCGCTGGCACGCAGG - Intronic
1119918814 14:78427119-78427141 AGGAGGCAGCGGTGCCCCCACGG + Intronic
1123988934 15:25668788-25668810 AGGGTGCTGCAGGGGCACCCAGG + Intergenic
1124493407 15:30172028-30172050 GGGGTGCACCCGTGGGCCCCAGG + Intergenic
1124750127 15:32366297-32366319 GGGGTGCACCCGTGGGCCCCAGG - Intergenic
1126112653 15:45184885-45184907 GGGGTGCAGGGGTGGCCATCTGG - Intronic
1127930845 15:63596361-63596383 AGAGGGCAGGGGTGGCCCACTGG + Intergenic
1128559306 15:68654277-68654299 AGGCTGCATCTCTGGCCCCCTGG - Intronic
1128776756 15:70326372-70326394 TGGGTGCAGCTGTGGGTCCCTGG - Intergenic
1132462440 16:62110-62132 AGGGTGCCCTGGTGCCCCCCGGG - Intronic
1132881547 16:2163764-2163786 AGGCTGCTGCGGCGGCCCCACGG + Intronic
1133115585 16:3576354-3576376 AGGGTGCAGGCGCCGCCCCCAGG - Intronic
1133431435 16:5740335-5740357 AGGGTGCAGCACAGTCCCCCAGG + Intergenic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1135690047 16:24529029-24529051 GGAGTGCAGTGGTGGCCTCCCGG + Intergenic
1136102572 16:28006807-28006829 AGGGTGCACTGGTGTCCACCTGG - Intronic
1137238343 16:46633663-46633685 AGGGTGCTGCAGTTGCACCCGGG + Intergenic
1139922853 16:70470742-70470764 AGGGTTCAGAGGTGGCCCCCAGG + Intronic
1140134641 16:72195165-72195187 TGGGTGCAGCGATGGCACCAGGG + Intergenic
1141446032 16:84058893-84058915 AGGCTGCAACCGCGGCCCCCGGG + Intronic
1142101580 16:88274883-88274905 ATGGGGCAGCACTGGCCCCCAGG + Intergenic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142923519 17:3212297-3212319 AGGATGCTGTGGTGGCCCCTTGG - Intergenic
1143165860 17:4897005-4897027 AGGGTGCACCACTCGCCCCCTGG - Intronic
1143289628 17:5819263-5819285 AGGGTGCAGCTGAGGCTCCATGG + Intronic
1144789717 17:17850697-17850719 TGGGTGCTGCAGTGGCCTCCCGG - Intronic
1144826420 17:18108066-18108088 AGGGTGCAGCCTGGGCCCCAAGG + Intergenic
1145008422 17:19351909-19351931 AGGGTCTAGCGCTGGCACCCAGG + Intronic
1146283404 17:31559383-31559405 AGGGGGCGGCGGCGGCCCCCAGG + Intergenic
1147249597 17:39145145-39145167 AGGGTGCAGGGGCAGCCCCGGGG + Intronic
1147540166 17:41350676-41350698 AGGGTGCAGCCGTGGCAGCTGGG + Exonic
1147545395 17:41397448-41397470 AGGGTGCAGCTGTGGCAGCTGGG + Exonic
1151571366 17:74927462-74927484 AGGGAGTGGTGGTGGCCCCCGGG + Intronic
1151667405 17:75553215-75553237 AGGGCCCAGCAGCGGCCCCCAGG - Intronic
1151685942 17:75646670-75646692 AGGGTGCAGCTCTGGTCACCTGG + Exonic
1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG + Intronic
1152073522 17:78145569-78145591 TGGGTGCAGCCTTGGCCTCCCGG + Intergenic
1152237815 17:79147586-79147608 AGGGGACAGCCATGGCCCCCAGG - Intronic
1152336429 17:79701984-79702006 AGGGTCCAGCGGAGGACACCAGG + Intergenic
1152534398 17:80942069-80942091 AAGGTTCAGCGGCGGCCGCCGGG - Intronic
1152538047 17:80961648-80961670 GGGGAGCAGCTGTGGCCCCTGGG - Intronic
1152561675 17:81081830-81081852 AGGGCCCAGCGATGGCCCCCTGG - Intronic
1153572721 18:6489311-6489333 GGGGTGCAGAGGAGGCCCCAGGG - Intergenic
1154377911 18:13824064-13824086 AGGTGGCAGCGGAGGCCGCCCGG + Intergenic
1155071971 18:22324828-22324850 AGGGTGGAGCGAGGGGCCCCTGG + Intergenic
1156368862 18:36454688-36454710 AGGTTGCAGGGGTGGGCTCCAGG - Intronic
1157584666 18:48793395-48793417 AGGGAGCAAAGCTGGCCCCCAGG - Intronic
1158643316 18:59220917-59220939 AGGGTGCAGCGCTCCCGCCCCGG + Intronic
1160404471 18:78635564-78635586 AGGCTGCAGCTGATGCCCCCGGG + Intergenic
1160953480 19:1678926-1678948 AGGGTGGAGCTGGGGCACCCAGG - Intergenic
1161396617 19:4047952-4047974 CGGGGGTCGCGGTGGCCCCCGGG + Exonic
1161595520 19:5149192-5149214 AGTGTGCAGCGGGGGGGCCCGGG - Intronic
1162032761 19:7924618-7924640 GGGGGGCAGCGGTGGGCACCGGG + Exonic
1163163639 19:15480452-15480474 AGGCCCCAGGGGTGGCCCCCAGG - Intronic
1163634440 19:18431668-18431690 AGGGTGGGCCGGGGGCCCCCTGG - Exonic
1164522340 19:28989064-28989086 AGGGTTCCACGGTGGCCCCCGGG + Intergenic
1164720340 19:30427351-30427373 AGGATGCAGCAGTGGCCCTTTGG + Intronic
1166039332 19:40192262-40192284 CGGGTGCAGCGGGGGCGCCGGGG - Exonic
1166393877 19:42424863-42424885 AGGGGGCAGCACTGGGCCCCGGG + Intronic
1166942542 19:46375540-46375562 GGGGCACAGCGGTTGCCCCCAGG - Intronic
1167262958 19:48469389-48469411 AGGAGGCGGCGGTGGCTCCCGGG + Exonic
1167341390 19:48918579-48918601 GCGGTGGAACGGTGGCCCCCAGG - Intronic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167426124 19:49430590-49430612 GGGGTGCAGGGGGTGCCCCCGGG + Exonic
1168103977 19:54155577-54155599 AGGGGGCAGCCCTCGCCCCCGGG - Exonic
927514141 2:23662128-23662150 AGGGTGCAGAGGGGGCTCTCTGG + Intronic
927711132 2:25327039-25327061 AGGGTGTGGCGATGGCTCCCTGG - Intronic
927844294 2:26463452-26463474 AGGGAGTAGCGCTGGGCCCCAGG + Intronic
929585385 2:43110757-43110779 AGGGTGGAGCCGTGGGTCCCTGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
934769318 2:96897984-96898006 AAGCTGCAGCGGAGGCCCCATGG - Intronic
938483588 2:131681900-131681922 TGGGGGCAGCGCTGGACCCCAGG + Intergenic
940124437 2:150309038-150309060 AGGGTGGGGCGATGGCCCACTGG + Intergenic
946923635 2:224604150-224604172 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
947398243 2:229707547-229707569 GGGGTGCAGCTGTGGGCACCAGG - Intronic
947795148 2:232889924-232889946 AGAGTGCAGCTGTGGCCCTGAGG - Intronic
948461110 2:238130447-238130469 AGGCCTCAGAGGTGGCCCCCGGG + Exonic
948825185 2:240570581-240570603 AGGATGCAGCGGAAGCTCCCTGG + Intronic
948858951 2:240743639-240743661 AGGATGCTGGGGTGGCCCCGGGG - Intronic
948900788 2:240956026-240956048 AGGCAGGAGGGGTGGCCCCCTGG - Intronic
948917044 2:241039652-241039674 AGGGTGTAGGAGTGGCCCCTGGG - Intronic
1170770971 20:19332275-19332297 AGGCCACAGCGGTGGCCCACTGG - Intronic
1170969228 20:21102510-21102532 GGGGTGCAGCGGCGACCCTCTGG + Intergenic
1171810074 20:29740675-29740697 AGGACGCAGCGGTGCCGCCCTGG + Intergenic
1173921982 20:46753091-46753113 CGGGTGCAGCAGGGGCTCCCCGG - Intergenic
1174344598 20:49920739-49920761 AGGGTGCAGACCTGGCACCCAGG - Intergenic
1175631368 20:60540031-60540053 AGGGTGCACTGTTGTCCCCCAGG - Intergenic
1175890476 20:62313721-62313743 AGGGTGACACGGTGGCCCCTGGG - Exonic
1176715068 21:10343293-10343315 TGGGGGCAGCGCTGGACCCCAGG - Intergenic
1178725429 21:35047076-35047098 AGTGTGCAGTGCTGGCCCCTGGG - Intronic
1179719341 21:43306492-43306514 AGGGTGCATGCGTGGCCCCCGGG - Intergenic
1179923538 21:44520454-44520476 AGGGTGGGGCGGTGGTCACCTGG + Intronic
1180484665 22:15784355-15784377 TGGGGGCAGCGCTGGACCCCAGG + Intergenic
1181629872 22:24145143-24145165 AGGGTCCAGTGGTGGCCAGCTGG - Intronic
1182129772 22:27842401-27842423 AGGGGGCAGCCAAGGCCCCCCGG + Intergenic
1182427825 22:30284204-30284226 AGTGAGCAGCAGGGGCCCCCCGG - Intergenic
1182436592 22:30334736-30334758 AGGTTGCAGCGGTATCCCCAAGG - Intronic
1183230155 22:36577079-36577101 AGGGGGCAGCAGAGGCCCCCGGG - Intronic
1183746995 22:39697782-39697804 AGGGTGCAGGGGTGGGTGCCTGG + Intergenic
1184069953 22:42141471-42141493 AGGGTACAGCTGGGGGCCCCTGG - Intergenic
1184101891 22:42345124-42345146 AGGGTCCAGCTGTGCCACCCTGG + Intergenic
1184357764 22:43994085-43994107 AGGGTGCTGAGAGGGCCCCCTGG + Intronic
1184858694 22:47160949-47160971 AGGGAGCAGCCAAGGCCCCCGGG - Intronic
950188681 3:10961192-10961214 AGGGCGAAGGGGAGGCCCCCAGG - Intergenic
950263610 3:11559512-11559534 AGGGTGCTGGGGAGGGCCCCAGG - Intronic
951555552 3:23917317-23917339 GGGGTGGAGAGGCGGCCCCCGGG + Intronic
953117366 3:40006400-40006422 AGGCTGCTGTGGTGGTCCCCAGG + Intronic
953142721 3:40244562-40244584 GGGCTGCAGCCGTGGCCACCTGG - Exonic
954714839 3:52521832-52521854 AGGCTGCAGCTCTGTCCCCCAGG - Exonic
954873276 3:53784133-53784155 AGGGGGCAGCGGAGACCCCCGGG - Intronic
956374816 3:68603250-68603272 AAGGTGCAGCGAAGGCCACCTGG + Intergenic
956603952 3:71053007-71053029 AGGATGCAGCGGAAGCTCCCAGG - Intronic
961435298 3:126912632-126912654 AAGGCCCAGAGGTGGCCCCCAGG + Intronic
961551333 3:127672162-127672184 AGGGTGCCGCGGGAACCCCCTGG + Intronic
963205086 3:142625516-142625538 ATGTTGGAGCGGTGGTCCCCAGG + Intronic
967829917 3:193909899-193909921 GGGGTGCCCTGGTGGCCCCCAGG + Intergenic
968591025 4:1459774-1459796 GTGGTGCAGCGGGAGCCCCCAGG + Intergenic
968864609 4:3199963-3199985 AGGGTGCTGGGCTGGCGCCCTGG - Intronic
969253879 4:5989804-5989826 GGGGTGCAGGGGTGCCCCCGAGG - Exonic
971257781 4:25030336-25030358 TGGGTGGAGTGTTGGCCCCCGGG - Intronic
971280527 4:25239434-25239456 AGGGTGCTGCTGGGTCCCCCTGG - Intronic
971281675 4:25246816-25246838 AGGGTGCTGCTGGGTCCCCCTGG - Intronic
972960788 4:44449031-44449053 AGGCTGCAGCCGCGGCTCCCGGG + Intergenic
979899783 4:126201738-126201760 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
981713072 4:147727992-147728014 AGGGGTCAGCGGTGGCCCCCAGG - Intergenic
985489586 5:171591-171613 AGGCCGCAGCGGGGGCCACCTGG + Intronic
985526838 5:408204-408226 GGGGTGCAACCCTGGCCCCCAGG - Intronic
985572977 5:660404-660426 AGGGTGCAGCGTTTGTCCCTGGG - Exonic
985673084 5:1216364-1216386 GGGATGCAGAGGTGGCCCCAGGG - Intronic
986058601 5:4164489-4164511 AGGGTCTAACGGTGGCTCCCAGG - Intergenic
990881913 5:60547969-60547991 AGGGTGGTGCTGTGGCCCGCAGG - Intergenic
991668833 5:69026681-69026703 AGGGTGCTGAGGTGGCCTTCAGG + Intergenic
992431763 5:76716652-76716674 AGGATGGAGCGGAAGCCCCCTGG + Intronic
995512472 5:112922378-112922400 AGGGTGTGGCGCTGTCCCCCTGG - Exonic
996525805 5:124478231-124478253 TGGCTGCAGCGGTGACCCCCAGG - Intergenic
997517803 5:134503334-134503356 AGGGTTCAGGTGTGGCCCCCAGG + Intergenic
998002614 5:138636782-138636804 GGGGTGCAGAGGAGGCTCCCTGG + Intronic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
1002060138 5:176621024-176621046 AGGGTCTAGCGCTGGGCCCCAGG - Intronic
1002864504 6:1109011-1109033 AGGGTGCAGTCCTAGCCCCCAGG + Intergenic
1003770224 6:9290883-9290905 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
1004176135 6:13341773-13341795 AGGGTGCAGCTGTGGCTCATGGG - Intergenic
1007422449 6:41727937-41727959 AGCCTGCAGAGGTGACCCCCAGG + Intronic
1007556576 6:42771266-42771288 CGGGCGCAGCGGCGGCCCGCAGG - Intronic
1007821111 6:44561332-44561354 GGGGTGGAGCGGCGGCCCCCAGG - Intergenic
1010794926 6:80107156-80107178 AGGGTGGAGGGGTGGTGCCCAGG + Intronic
1012450903 6:99351331-99351353 AGGAAGCAGCAGTGGGCCCCTGG - Intergenic
1014913372 6:127118818-127118840 CGGCTGCAGCGGCGGCCCCTTGG - Exonic
1016384019 6:143513616-143513638 ACGGTGGAGCTGTGGCCCCGGGG - Intergenic
1016688254 6:146905757-146905779 AGGCTGCAGCAGTGGCCCTGGGG + Intergenic
1017520344 6:155196200-155196222 AGGGATCAGAGGTGACCCCCAGG + Intronic
1018653254 6:166008574-166008596 AGGGTGGGCCGGTGGCTCCCTGG - Intergenic
1018804769 6:167249964-167249986 TGGGTGCAGAGATGCCCCCCAGG - Intergenic
1019451322 7:1100179-1100201 AGGGTGCAGTGGTGGCCGGCTGG - Intronic
1020142832 7:5621949-5621971 ACGGGGCAGGGGTGGCACCCAGG + Intronic
1020452667 7:8337640-8337662 AGGGAGCAGAGATGGCACCCAGG + Intergenic
1023734965 7:43226732-43226754 AGGGTGGAGCAGAAGCCCCCAGG + Intronic
1024975784 7:55112553-55112575 AGGGGGCAGCCATGGCCCTCGGG - Intronic
1025861862 7:65337889-65337911 AGGGTACAGCCCTTGCCCCCTGG - Intergenic
1026977378 7:74506859-74506881 AGGATGCAGCTCTGTCCCCCAGG + Intronic
1029249539 7:99225992-99226014 TGGGAGAAGCGTTGGCCCCCAGG - Intergenic
1035687526 8:1536592-1536614 AGGATGCAGGGCTGGCCCCATGG - Intronic
1037822291 8:22140845-22140867 AGGGTGGGGAGGTGGCCTCCAGG - Intronic
1037826681 8:22164405-22164427 AGTGGGCAGAGGTGGCGCCCAGG + Exonic
1038644769 8:29352213-29352235 GGAGTGCAGGGATGGCCCCCGGG - Intergenic
1039476797 8:37843038-37843060 AGGGTTCAGAGGTGGCACACCGG + Exonic
1039793280 8:40892074-40892096 AGGGTGGAGTGGTGGCCCAGTGG - Intronic
1041273451 8:56132265-56132287 GGGGAGCAGAGGTGGCCCCCAGG + Intergenic
1042563681 8:70092453-70092475 AGGCTGCAGGGGTGTCCCGCGGG + Intergenic
1049013053 8:139900379-139900401 AGGGTGCAGTGGTGGCAGCCAGG - Intronic
1049351736 8:142168148-142168170 GGGGTGCAGGGGTGGGCCCTGGG - Intergenic
1049530689 8:143153353-143153375 AGGCTGCAGGCGTGGCCTCCGGG - Intergenic
1049765423 8:144353190-144353212 AGGGGGCAGGGGAGGCCCTCTGG - Intronic
1051419771 9:16877501-16877523 ACGGTGCAGCGGTGGGCCGAAGG + Intergenic
1053270519 9:36746336-36746358 GGGGTGCAGCAGGGGCCCCTCGG - Intergenic
1056949382 9:91029820-91029842 ACAGGACAGCGGTGGCCCCCGGG - Intergenic
1057164140 9:92913219-92913241 TAGGTGCAGCTGTGGCCCCACGG + Intergenic
1057802295 9:98197860-98197882 AGGGTGCAGCTGGGACCCCCAGG + Intergenic
1058686972 9:107488402-107488424 AGATTGCAGCGCTGGCGCCCTGG - Intronic
1060811668 9:126614060-126614082 GGGGTGCAGGGGCGGCCCCGCGG - Intergenic
1061797760 9:133098276-133098298 AGTGTACAGAGGTGGCGCCCGGG + Exonic
1061899620 9:133666247-133666269 GGGGTGCAGGGGTGGCCCCCAGG - Intronic
1061938550 9:133871941-133871963 AGGGTGGAGCGATGACCCCATGG - Intronic
1062551803 9:137091071-137091093 AGTGTGGAGCAGTGGCCCCATGG - Intronic
1189333602 X:40156960-40156982 TGGGTGCAGCTGAGGCTCCCTGG + Intronic
1192234894 X:69289470-69289492 AGAGTGCAGAGCTGGCTCCCAGG - Intergenic
1200074700 X:153545149-153545171 GGAGTGCAGATGTGGCCCCCAGG + Intronic