ID: 1151955032

View in Genome Browser
Species Human (GRCh38)
Location 17:77375923-77375945
Sequence ATATGGGAGTTGGACAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151955018_1151955032 26 Left 1151955018 17:77375874-77375896 CCTGGTGCCCAAGGAGCCTGGAG 0: 1
1: 0
2: 4
3: 37
4: 349
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118
1151955024_1151955032 10 Left 1151955024 17:77375890-77375912 CCTGGAGTATAGTTGGAGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118
1151955015_1151955032 30 Left 1151955015 17:77375870-77375892 CCTCCCTGGTGCCCAAGGAGCCT 0: 1
1: 0
2: 1
3: 34
4: 280
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118
1151955020_1151955032 18 Left 1151955020 17:77375882-77375904 CCAAGGAGCCTGGAGTATAGTTG 0: 1
1: 1
2: 0
3: 22
4: 595
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118
1151955019_1151955032 19 Left 1151955019 17:77375881-77375903 CCCAAGGAGCCTGGAGTATAGTT 0: 1
1: 1
2: 1
3: 16
4: 409
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118
1151955017_1151955032 27 Left 1151955017 17:77375873-77375895 CCCTGGTGCCCAAGGAGCCTGGA 0: 1
1: 0
2: 1
3: 30
4: 230
Right 1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151955032 Original CRISPR ATATGGGAGTTGGACAACCT TGG Intronic
903231616 1:21925784-21925806 ACTTGGGAGTCTGACAACCTGGG + Intronic
905438495 1:37976671-37976693 TTATGGGAATTGGGCAACTTTGG + Intronic
906660238 1:47576726-47576748 ATAGGGGAGATGAACAAACTTGG + Intergenic
906697064 1:47830149-47830171 ATCTGGGAGGGGGACATCCTGGG - Intronic
908272256 1:62433486-62433508 ATATGGGACTTGAGCATCCTCGG + Intergenic
909675884 1:78238701-78238723 ATAAGGGTCTTGTACAACCTTGG + Intergenic
911661565 1:100507754-100507776 ACCTGGGAGGTGGAGAACCTGGG - Intronic
912644510 1:111379525-111379547 ATATAGGAATTGGACAGCCAAGG + Intergenic
912798992 1:112709606-112709628 ATCTTGGAGTTGGTCACCCTTGG - Intronic
917031396 1:170696175-170696197 ATATGGCAGTAGGACAAGCCAGG + Intronic
920631650 1:207658840-207658862 ATCTGGGAGATGGACAGCCAGGG + Intronic
920799115 1:209170858-209170880 ATATGGTAGTTGGAAAACTATGG - Intergenic
923874640 1:238034489-238034511 AGCTGGGAGGTGGACATCCTGGG + Intergenic
1063730925 10:8696332-8696354 ATTTGGGAGCTGCACATCCTTGG + Intergenic
1065741547 10:28801582-28801604 ATGAAGGAGTTGGACAAGCTGGG + Intergenic
1066176101 10:32907937-32907959 AGCTGCGAGTTGGACAAGCTTGG + Intronic
1068720604 10:60241560-60241582 ACCTGGGAGTTGGGAAACCTGGG - Intronic
1073198044 10:101711115-101711137 ATGTGTGTCTTGGACAACCTTGG + Intergenic
1074458175 10:113613541-113613563 ATATGTGAGTTGGCTAACATTGG - Intronic
1076115138 10:127890273-127890295 ATCTGGATGTTGGACAAACTAGG + Intronic
1076680884 10:132170552-132170574 ATCTGGGACTTGGACATCCATGG + Intronic
1078072400 11:8124912-8124934 ACATGGGAATTGGGAAACCTTGG + Intronic
1078078140 11:8180290-8180312 AGATGGGAATTTGACAGCCTGGG + Intergenic
1078977416 11:16494821-16494843 ATAGGGGAGCTTGTCAACCTTGG + Intronic
1081536196 11:43998013-43998035 ATTTTGGAGTTAGGCAACCTTGG + Intergenic
1087736999 11:101845488-101845510 ATTTTGGAGTTGGACAGTCTGGG + Intronic
1091781909 12:3219157-3219179 AGCTCGGAGTTGGACAGCCTTGG + Intronic
1094258500 12:28464396-28464418 AGCTGGGAGCTGTACAACCTGGG - Intronic
1094497916 12:31000608-31000630 GTTTGGGAGTTGGAGAACCTGGG - Intergenic
1095604745 12:44053162-44053184 AGATGCGAGCTGGACATCCTAGG + Intronic
1095979772 12:47965053-47965075 ATGTGGAAGTTGAAAAACCTGGG - Intronic
1096980546 12:55726082-55726104 GTATGGGACTTGGGAAACCTGGG - Intronic
1099153445 12:79144528-79144550 AAATGGGAATTGTACATCCTGGG - Intronic
1099248459 12:80222113-80222135 AGATGGGATTTGTAAAACCTGGG + Exonic
1099712516 12:86245197-86245219 ATCAGGGAGTTGTAGAACCTTGG - Intronic
1101138060 12:101766224-101766246 GTATTGGAGTTGGACAGCCCTGG - Exonic
1106055074 13:26229757-26229779 CAAAGGGACTTGGACAACCTGGG - Intergenic
1111500814 13:89118109-89118131 ATATGGGAGGTGGAGACTCTGGG + Intergenic
1113782386 13:112984044-112984066 AGAGGGGAGATGGACAACCCTGG - Intronic
1117463642 14:55971367-55971389 ATAGGGGAGTTGCTCAATCTGGG - Intergenic
1120451358 14:84671060-84671082 ATATGGTAGTTTCTCAACCTTGG + Intergenic
1120869909 14:89327974-89327996 ATTTGGGAGTCTGAAAACCTGGG - Intronic
1121386653 14:93533494-93533516 ATATGGGAGTGAGACCATCTGGG - Intronic
1124667863 15:31609299-31609321 ATCTGGGAGGTGGATAGCCTGGG + Intronic
1131562058 15:93453032-93453054 AAATGTGAGTTTGACAACTTTGG + Intergenic
1133707262 16:8366623-8366645 GTATGGGAGTTAGGAAACCTGGG - Intergenic
1135917742 16:26621306-26621328 ATATGGGATGTGGACAGCCCTGG + Intergenic
1148063154 17:44850411-44850433 TTAGGGGAGTTGGACAGCCCCGG - Exonic
1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG + Intronic
1158443736 18:57500835-57500857 ACATTGGAGTTGGCCAACTTTGG - Intergenic
925387947 2:3475713-3475735 GTCTGGGCGTTGGACAGCCTGGG + Intronic
927609061 2:24518613-24518635 ATATGTGAGTTGAACAAGGTAGG + Intronic
929696056 2:44116388-44116410 ATCTGGGAGTTGGACAGTCCTGG + Intergenic
930125099 2:47789673-47789695 ATAAGGGACTTGGACATCCAAGG - Intronic
939742531 2:145927121-145927143 AAATGGAACTTGGGCAACCTGGG - Intergenic
940048827 2:149439175-149439197 ATATGGGAGTTATACAACACTGG - Intronic
941758244 2:169211950-169211972 ATATTGGAGTTGGCATACCTTGG + Exonic
944171732 2:196786744-196786766 GTATGGGGGATGGACAACTTTGG - Intronic
944316572 2:198291401-198291423 ACCTGGGAGCTGGACAAGCTGGG + Intronic
1169949139 20:11023629-11023651 TGATGGTGGTTGGACAACCTTGG - Intergenic
1170523188 20:17209807-17209829 AAATGGGAGTTGGAGAATCAGGG + Intergenic
1173024679 20:39296945-39296967 ACATAGCAGTTGGAGAACCTGGG + Intergenic
1174475512 20:50793383-50793405 ATATTGTAGTTGGCCACCCTAGG - Intergenic
1177105249 21:16946650-16946672 ATCTGGGAGTTGGAAATCTTAGG - Intergenic
1177340066 21:19786820-19786842 ATATGGGAGATGGATAACTGAGG + Intergenic
949362908 3:3250492-3250514 ATAGGGGAGTTGGACCACATGGG + Intergenic
955198628 3:56829438-56829460 CTATGGGCTTTGAACAACCTGGG - Intronic
962938244 3:140101455-140101477 ATATAAGAGTTGCCCAACCTGGG - Intronic
963419373 3:145040718-145040740 ATATAGGAGTCTGACAAACTGGG + Intergenic
963698009 3:148586399-148586421 ATAAGGTAGGTGGAAAACCTAGG - Intergenic
966727042 3:183117287-183117309 ATATGAGAGTAGGAGAGCCTTGG - Intergenic
967471789 3:189870489-189870511 ATAAGGGACTTGAGCAACCTAGG + Intronic
970797042 4:19925108-19925130 ATTTGGCAGTTGGACTGCCTGGG + Intergenic
971233417 4:24819295-24819317 ACCCTGGAGTTGGACAACCTGGG - Intronic
976686388 4:87819671-87819693 ATCTGGGAGTTGGATAGCCTTGG - Intergenic
979168088 4:117562125-117562147 ATATGGGAGTAGGAGAATATGGG - Intergenic
980184915 4:129448928-129448950 ACATGGAAATTGAACAACCTTGG + Intergenic
986836905 5:11649235-11649257 ATTTTGGACTTAGACAACCTGGG - Intronic
991143633 5:63275177-63275199 ATATGGGTATTAGCCAACCTTGG + Intergenic
992184619 5:74232123-74232145 ATGTGGGACTTGGACAGTCTGGG + Intergenic
992351171 5:75930651-75930673 ATATGGAAGTTGGAAATCCATGG + Intergenic
996591170 5:125149300-125149322 AGATGGGAGTTGGATATGCTGGG + Intergenic
996904180 5:128578540-128578562 ATAGGGGAGTTGAACAAGCATGG + Intronic
998420731 5:141983528-141983550 CTATGGGAGTTCCACAACATGGG - Exonic
1002958014 6:1887787-1887809 ATAAGGGAGTTGAGCATCCTTGG - Intronic
1008085057 6:47235702-47235724 AAATGGGAGTCAGAAAACCTGGG - Intronic
1010370297 6:75099405-75099427 ATATAGTAGTTGGAGAAACTTGG - Intronic
1011233278 6:85187704-85187726 ATCTGGGAGGTGGACAGCCTTGG + Intergenic
1012116317 6:95303168-95303190 ATTTGGGAATTGGCCAACATAGG - Intergenic
1015308920 6:131743316-131743338 ATTTTGGAGTTGGACCTCCTGGG + Intronic
1015725431 6:136294711-136294733 GTCTGGGAGTTGGAGACCCTTGG - Intergenic
1016090823 6:139976658-139976680 ATATGGAAGTTGTAGAACTTTGG - Intergenic
1017242305 6:152183805-152183827 ATATGAAAGTTGGACAAATTTGG + Intronic
1024730057 7:52243760-52243782 ATATGGGAATTCTGCAACCTGGG + Intergenic
1026027271 7:66755993-66756015 ATATGAAAGTTGGTGAACCTTGG + Exonic
1032242026 7:130169792-130169814 ATCTGGGAGTCGGAAAACCTGGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032766916 7:135002677-135002699 ATACAGGGTTTGGACAACCTAGG + Intronic
1033682887 7:143613341-143613363 CTATGGGAGTTAGACAACAGAGG - Intergenic
1033701724 7:143844301-143844323 CTATGGGAGTTAGACAACAGAGG + Intergenic
1037567855 8:20132628-20132650 ATATGTGAGCTGGAAAATCTTGG - Intergenic
1037684639 8:21128614-21128636 AGATGGGAGTTAGAGAACCAGGG - Intergenic
1041051485 8:53939137-53939159 ATATGGGAGGAGGTCAACATGGG - Intronic
1042332847 8:67599394-67599416 AGAGGGGAGTTGGGCAACCAGGG - Intronic
1044796671 8:95907899-95907921 ATATAAGAATTAGACAACCTGGG + Intergenic
1046378884 8:113426880-113426902 ATCTGGGACTTGACCAACCTTGG + Intronic
1047663512 8:127064702-127064724 ACATGGTATTTGGACAGCCTAGG + Intergenic
1047861506 8:128972243-128972265 ATAAGGGACTTGGCCAAACTTGG + Intergenic
1050149511 9:2605397-2605419 ATTTGGGAGTTGGACAAATCTGG - Intergenic
1050516342 9:6447846-6447868 AAATTGGTGTTGGAGAACCTTGG + Intronic
1054724064 9:68632821-68632843 ATTTGGGAGTTTGACAAACAAGG - Intergenic
1057119546 9:92559040-92559062 AGCTGGGAGGTGGACAGCCTCGG - Intronic
1057394365 9:94666657-94666679 ATGTGGCTGTTGAACAACCTGGG + Intergenic
1061610703 9:131743721-131743743 ATATGTGACTTGGCCAGCCTAGG + Intergenic
1186872817 X:13789414-13789436 ATATAGGAGCTAGACCACCTAGG + Intronic
1190324055 X:49195901-49195923 ATTTAGGAGCTGTACAACCTTGG - Intronic
1191114164 X:56834437-56834459 ATTTGCAAGTTGGACAACCAGGG + Intergenic
1192781701 X:74299909-74299931 AACTGGGAGTTGGTAAACCTGGG + Intergenic
1196034402 X:111128289-111128311 ATTTGGGAGTTGGTGAGCCTGGG + Intronic
1197752153 X:129972212-129972234 ATGTGCTAGTTGGACAAGCTTGG + Intergenic
1198230795 X:134687282-134687304 AACTGTGAGTTGGACAAGCTTGG - Intronic
1198595079 X:138227399-138227421 ATATGGAAGTTGGACTAAATGGG + Intergenic
1200283742 X:154801257-154801279 AAATTGGAGTTTGCCAACCTGGG - Intronic
1201742657 Y:17341020-17341042 ATATGGGAGAGGGAGACCCTGGG + Intergenic