ID: 1151956896

View in Genome Browser
Species Human (GRCh38)
Location 17:77384620-77384642
Sequence ACTCTTGGTGGTTCTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151956896 Original CRISPR ACTCTTGGTGGTTCTGGCTC AGG (reversed) Intronic