ID: 1151957086

View in Genome Browser
Species Human (GRCh38)
Location 17:77385836-77385858
Sequence CCCAGGAGGGTGAAGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1131
Summary {0: 1, 1: 1, 2: 7, 3: 142, 4: 980}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151957077_1151957086 2 Left 1151957077 17:77385811-77385833 CCAAAGGCAGGGTCCTTGACCTC 0: 1
1: 0
2: 1
3: 40
4: 276
Right 1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG 0: 1
1: 1
2: 7
3: 142
4: 980
1151957073_1151957086 18 Left 1151957073 17:77385795-77385817 CCACAAGGAATGTGGGCCAAAGG 0: 1
1: 0
2: 2
3: 17
4: 182
Right 1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG 0: 1
1: 1
2: 7
3: 142
4: 980

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151957086 Original CRISPR CCCAGGAGGGTGAAGTGGGC TGG Intronic
900191546 1:1354303-1354325 CCCAGGAGACTGAGGTGGGCGGG - Intronic
900203705 1:1422156-1422178 CCTGGGAGGCTGAAGGGGGCTGG - Intergenic
900330919 1:2133996-2134018 CCCAGGTGGGTGGAGTGTGGAGG + Intronic
900779979 1:4611807-4611829 GCCGGGAGGGGGCAGTGGGCGGG - Intergenic
900992771 1:6105615-6105637 CCCAGGAAGCAGCAGTGGGCAGG + Intronic
901006129 1:6172431-6172453 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
901046107 1:6396674-6396696 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901312086 1:8277373-8277395 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901559227 1:10056919-10056941 CTCAGGAGGCTGAGGTGGGCTGG - Intronic
901677131 1:10892072-10892094 CCCAGGCGGGTAGTGTGGGCTGG - Intergenic
901834435 1:11914864-11914886 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902262945 1:15240521-15240543 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902492478 1:16794591-16794613 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
902591170 1:17475793-17475815 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902606694 1:17573111-17573133 CCCAGGAGGATGAGGCAGGCAGG - Intronic
902994933 1:20217056-20217078 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903048783 1:20585591-20585613 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903067241 1:20706986-20707008 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
903161388 1:21491522-21491544 CTCAGGAGGCTGATGTGGGAGGG - Intergenic
903377861 1:22877628-22877650 CCCAGGCAGGTGAGGGGGGCAGG + Intronic
903437082 1:23358321-23358343 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
903505278 1:23829900-23829922 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
903547545 1:24136060-24136082 CTCAGGAGGTTGAAGTGGGAGGG - Intronic
903639867 1:24851487-24851509 CTCGGGAGGGTGAAGGGGGGAGG - Intergenic
903767586 1:25744543-25744565 CCAAGGAGGGAGCAGAGGGCTGG - Intronic
904009437 1:27381403-27381425 GCCTGGAGGGTGCAGTAGGCAGG + Intronic
904425717 1:30421648-30421670 CCTAGGAGGGTGCGGTGGTCAGG - Intergenic
904671471 1:32169293-32169315 CCCAGGAGGCTGCAGTGAGCTGG + Intronic
904941941 1:34169925-34169947 ACCAGGAGGGAGAAGTGAGAAGG + Intronic
905078206 1:35293106-35293128 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905236257 1:36551536-36551558 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
905393838 1:37654751-37654773 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905398640 1:37685315-37685337 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905640903 1:39589137-39589159 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905719505 1:40185132-40185154 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
905766593 1:40606909-40606931 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905832789 1:41086660-41086682 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
905861228 1:41353337-41353359 CTCAGAAGGCTGAGGTGGGCCGG - Intergenic
905911582 1:41658642-41658664 CTCAAGGGGGTGAAGTGGCCTGG + Intronic
905933331 1:41805259-41805281 CCCAGGAGGCGGAAGTTGCCAGG + Intronic
906044437 1:42817116-42817138 TCCAGGAGAGGGAAGAGGGCAGG - Exonic
906226524 1:44127002-44127024 CTCAGGAGGCTGAAGTGGAAAGG - Intronic
906348515 1:45036904-45036926 CTCAGGAAGCTGAAGTGGGAGGG - Intronic
906408730 1:45562447-45562469 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
906494454 1:46294213-46294235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907256317 1:53181700-53181722 CGCAGGAGGCTGAGGTGGGAGGG + Intergenic
907296135 1:53456075-53456097 CTCGGGAGGCTTAAGTGGGCAGG + Intergenic
907361134 1:53916075-53916097 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
908022902 1:59916623-59916645 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
908085023 1:60622710-60622732 CTCAGGAGGCTGGAGTGGGCTGG + Intergenic
908343213 1:63204172-63204194 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
908455527 1:64300697-64300719 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
908540120 1:65114205-65114227 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
908777421 1:67654031-67654053 CCCAGGAGTTTGAAGTCAGCTGG + Intergenic
910091828 1:83473559-83473581 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911110951 1:94184644-94184666 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
911324936 1:96460050-96460072 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
912452207 1:109774136-109774158 CCCAGAGGGATGAGGTGGGCTGG - Intronic
913657448 1:120974883-120974905 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914008797 1:143757965-143757987 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914080855 1:144410410-144410432 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914175769 1:145278942-145278964 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914316510 1:146517830-146517852 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
914497846 1:148215531-148215553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
914647427 1:149666618-149666640 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914807270 1:151000884-151000906 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
914937513 1:151993718-151993740 CCCAGGAGGGGCGCGTGGGCCGG + Intronic
915235800 1:154480553-154480575 CGCAGGATGGGGAGGTGGGCAGG - Exonic
915381152 1:155441871-155441893 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
915499057 1:156301901-156301923 GCCAGGTGGGCTAAGTGGGCAGG + Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
916073596 1:161186891-161186913 CTCAGGAGGTTGAGGTGGGAGGG + Exonic
917343783 1:174007569-174007591 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
918001597 1:180502424-180502446 CCCAGGGAGTAGAAGTGGGCAGG - Exonic
918326004 1:183411409-183411431 CTCAGGAGGCTGAGGTGGGACGG - Intronic
918950189 1:191126379-191126401 CTGAGAAGGGTGAAATGGGCAGG + Intergenic
918997065 1:191775162-191775184 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
919015468 1:192027782-192027804 CTTAGGAGGGTGATGTGTGCAGG + Intergenic
919631187 1:199961395-199961417 CTCAGGAGGCTGAAGTGGAAAGG + Intergenic
919646003 1:200095222-200095244 CTCAGGAGGCTGATGTGGGAGGG - Intronic
919714917 1:200766249-200766271 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
919740531 1:200978792-200978814 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
920367910 1:205457552-205457574 CCAAGGAGGCGGAAGTGGGGGGG + Intergenic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920439002 1:205966183-205966205 TCCAGGAGGGAGAAGTGGACTGG + Intergenic
920624479 1:207583181-207583203 CACAGGAGGGTGAGGTGCCCTGG + Intronic
922118569 1:222638587-222638609 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
922248968 1:223829224-223829246 CCCAGGAAGCTGAGGTGGGAGGG + Intronic
922440761 1:225653375-225653397 CCCAGAGGGGTGCAGGGGGCGGG - Intergenic
922466040 1:225846038-225846060 CCCAGGAGGGAGAAGAGGGATGG + Exonic
922533935 1:226365882-226365904 CCCAGGTTGGAGGAGTGGGCAGG + Intronic
922643276 1:227258065-227258087 CTCAGGAGACTGAAGTGGGAGGG + Intronic
922976496 1:229788531-229788553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
923123076 1:231012313-231012335 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
923527970 1:234787941-234787963 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
923630826 1:235648951-235648973 GGCGGGAGGGTGAAGTGGGGAGG - Intronic
923665671 1:235996547-235996569 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
923774217 1:236964076-236964098 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
924227416 1:241933415-241933437 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
924257487 1:242197004-242197026 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
924446128 1:244133263-244133285 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
924482650 1:244451397-244451419 CCCTGGAGGAAGAGGTGGGCTGG - Intronic
1062988205 10:1789826-1789848 CCCTGGAGGGAGAAGTGGAGGGG - Intergenic
1063130477 10:3173093-3173115 GATAGGAGGGGGAAGTGGGCAGG + Intergenic
1063487035 10:6429803-6429825 CCCAAGAGGATGCAGTGAGCTGG - Intronic
1063828463 10:9925289-9925311 CTCAGGAAGCTGAAGTGGGAGGG - Intergenic
1063997011 10:11629042-11629064 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064059827 10:12128592-12128614 CTCGGGAGGCTGAGGTGGGCAGG + Intergenic
1064091256 10:12387612-12387634 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1064316593 10:14263323-14263345 CGCAGGAGGGGGAAGGGGACGGG + Intronic
1064326210 10:14353902-14353924 CCCAGGAGAGTGGAGATGGCTGG - Intronic
1064376445 10:14800859-14800881 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064520838 10:16199004-16199026 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1065185437 10:23166050-23166072 CCCGGGAGGCTGAGGTGGGAGGG + Intergenic
1065211198 10:23405122-23405144 CTCAGGAGGCTGAGGTGGGGGGG - Intergenic
1065339166 10:24687106-24687128 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065842527 10:29714850-29714872 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065946386 10:30608945-30608967 CTCAGGAGGTTGAGGTGGGAGGG - Intergenic
1065961208 10:30735684-30735706 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1065984219 10:30933508-30933530 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1066045793 10:31594634-31594656 GCCAGGAGGGTGCAGAGGGCTGG + Intergenic
1066317474 10:34262372-34262394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1066372112 10:34825922-34825944 CTCAGGAGGCTGAGATGGGCGGG + Intergenic
1066599843 10:37093132-37093154 CCCAGGAGGAAAAAGTAGGCTGG + Intergenic
1067030342 10:42875407-42875429 CGAAGGAGGGTGCAGTGGGCAGG - Intergenic
1067097753 10:43313767-43313789 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1067571892 10:47377917-47377939 CCCAGGTGCCTGAAGTGGCCTGG - Intronic
1068088780 10:52407493-52407515 CCCAGGAGGCTGAGGTGCGAGGG - Intergenic
1068545427 10:58339211-58339233 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069341853 10:67419504-67419526 TACTAGAGGGTGAAGTGGGCTGG - Intronic
1069489764 10:68851193-68851215 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1069674023 10:70234133-70234155 CCCAGGTGGGTTAAGTAGGGTGG - Intergenic
1069909884 10:71752530-71752552 CCCAGAGTGGTGCAGTGGGCTGG - Intronic
1070035577 10:72719977-72719999 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1070074564 10:73122677-73122699 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1070085050 10:73228971-73228993 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1070221292 10:74448209-74448231 CTTGGGAGGGTGAAGTGGGAGGG + Intronic
1070310938 10:75273315-75273337 CCCAGGAGGTTGGATTGGGCTGG + Intergenic
1070316218 10:75315250-75315272 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1070668283 10:78360706-78360728 GCCAGGAGGGTGCAGGTGGCAGG - Intergenic
1070809379 10:79289960-79289982 CCTGTGAGGGTGAAGAGGGCTGG - Intronic
1071545987 10:86529915-86529937 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1071575092 10:86719282-86719304 CGCAGGAGGCTGAAGTGGGAGGG + Intronic
1072641993 10:97218570-97218592 CCCAGGAGGCTGAGGTGGAAGGG - Intronic
1073060013 10:100728244-100728266 CCCGGGAGGCTGAGGTGGGAGGG + Intergenic
1073145092 10:101275382-101275404 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1073236488 10:102021182-102021204 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1073494637 10:103880039-103880061 CCCAGGCGGGTGAAGTGGGCGGG - Intergenic
1074314306 10:112347626-112347648 CTTAGGAGGCTGAAGTGGGAGGG + Intergenic
1074812989 10:117124101-117124123 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1074908639 10:117887145-117887167 CCCAGGAGGGAGAAGGGGAGAGG - Intergenic
1075076476 10:119354507-119354529 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1076279687 10:129235658-129235680 CCCAGGAGTGTGTAGTTGGTAGG + Intergenic
1076283942 10:129275298-129275320 CTCAGGGGGGTACAGTGGGCTGG - Intergenic
1076732773 10:132446711-132446733 GACAGGAGGGTGGGGTGGGCAGG + Intronic
1076891198 10:133284468-133284490 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1077027204 11:446164-446186 CCCAGGAGGCTGTTGGGGGCGGG - Intergenic
1077061026 11:617925-617947 CCCAGGATGGAGAACAGGGCAGG - Intronic
1077301624 11:1849916-1849938 TCCACGACGGTGATGTGGGCAGG + Intergenic
1077366428 11:2163126-2163148 CCCAGCAGCGTGTAGTGGGGTGG + Intergenic
1077412968 11:2412007-2412029 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
1077536104 11:3125046-3125068 TGCAGGAGGGAGGAGTGGGCAGG - Intronic
1077587143 11:3462437-3462459 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1077927697 11:6698241-6698263 CTCAGGAGGTTGAAGTAGGAGGG + Intergenic
1078259175 11:9688545-9688567 ATAAGGAAGGTGAAGTGGGCTGG + Intronic
1078261095 11:9709593-9709615 CCCGGGAGGCTGAAGTTGGTGGG - Intronic
1078346782 11:10556843-10556865 TCCAGGAGGAGGAAGTGGGGAGG - Intergenic
1079001271 11:16758870-16758892 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1079172534 11:18109968-18109990 CTCAGGAGGTTGAGGTGGGAGGG + Intergenic
1079934724 11:26602642-26602664 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1079987701 11:27215959-27215981 GGCAGGAAGGTGAAGTGGGGAGG + Intergenic
1080660782 11:34294220-34294242 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1081630556 11:44686746-44686768 CCCAGGAGAGTCCAGTTGGCTGG + Intergenic
1081856826 11:46309185-46309207 CCCAGAAGGTTCAAGTTGGCAGG - Intronic
1081867564 11:46367856-46367878 CCCAGGATGGTGAGGGGTGCAGG + Intronic
1081970506 11:47195087-47195109 GTCAGAAGGGTGGAGTGGGCAGG + Intergenic
1082011182 11:47450465-47450487 CCCAGGAGACTGAGGTGGGAGGG - Intergenic
1082095661 11:48127218-48127240 GTCGGGAGGGTGGAGTGGGCAGG + Intronic
1082099033 11:48156692-48156714 CACAGGAGGCTGAAGTGGGAGGG - Intronic
1083290880 11:61689317-61689339 CTCGAGTGGGTGAAGTGGGCAGG - Intronic
1083581242 11:63826919-63826941 CCCCGGAGGGGGAGCTGGGCAGG - Exonic
1083682691 11:64358710-64358732 CCCAGGACGATGGAGTGGGGTGG + Intergenic
1083809315 11:65094701-65094723 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1084065122 11:66699643-66699665 CCTAGGGGGGTGAATTGTGCTGG - Intronic
1084079405 11:66811059-66811081 CTCAGGAGGCTGAAGTGGGAAGG - Intronic
1084156080 11:67313290-67313312 CTCAGGAGGCTGAAGTGAGAGGG - Intergenic
1084243134 11:67836449-67836471 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1084556688 11:69879932-69879954 TCCAGGAAAGTGACGTGGGCTGG - Intergenic
1084654483 11:70507164-70507186 CCCAGGAGGCTGGGGCGGGCGGG - Intronic
1084829852 11:71760493-71760515 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1084884266 11:72193227-72193249 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1084899304 11:72297873-72297895 CCCAGGTGGGTGAGGGGAGCAGG + Intronic
1085062332 11:73459189-73459211 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1085189478 11:74605974-74605996 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1085469344 11:76747141-76747163 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1085633683 11:78141108-78141130 CTCAGGAGGCTGAGGTGGGGAGG - Intergenic
1086081481 11:82907645-82907667 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1086103451 11:83125803-83125825 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1086360006 11:86048792-86048814 CCCAGGAGGCTGAAGTGCAGTGG - Intronic
1086392510 11:86379874-86379896 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1086873779 11:92070823-92070845 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1086904769 11:92405641-92405663 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1087153491 11:94879429-94879451 CATGGGAGGGTGAAGTAGGCAGG - Intergenic
1087745887 11:101946398-101946420 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1088259910 11:107934324-107934346 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1088482989 11:110313608-110313630 CTCAAGAGGCTGAGGTGGGCCGG + Intergenic
1088868082 11:113868078-113868100 GCCAGGAGGCTGATGTGTGCTGG - Intronic
1089546229 11:119228213-119228235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1089834350 11:121357013-121357035 CCCAGAAAGGTAAAGAGGGCCGG - Intergenic
1089949282 11:122510236-122510258 CCCAGGATGGTGGCGTGGGAGGG + Intergenic
1089960845 11:122616073-122616095 CCCAGGAGGCTCAGCTGGGCAGG - Intergenic
1090106168 11:123855168-123855190 CCCAGTAAGGAGAAGTGGGTCGG - Intergenic
1090225567 11:125070130-125070152 GGCAGGAGGGTGAATTGGGCAGG + Intronic
1090247706 11:125228616-125228638 CCCTGGAGGGTCATGTGAGCCGG + Intronic
1090250766 11:125250156-125250178 CTCAGGAGGTTGAGGTGGGAGGG - Intronic
1090287265 11:125510778-125510800 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1090828467 11:130404500-130404522 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1090964333 11:131584988-131585010 CCAAGGGGGGTGCAGTGGGGGGG + Intronic
1092190469 12:6516086-6516108 CTCGGGAGGCTGAAGTGGGAGGG + Intronic
1092251088 12:6897430-6897452 CTTAGGAGGCTGAAGTGGGAGGG + Intronic
1092413385 12:8271185-8271207 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1092502898 12:9065357-9065379 CCCTGGAGCCTGCAGTGGGCAGG - Intergenic
1092898659 12:13037953-13037975 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1093023227 12:14221828-14221850 CCCAGGAGGTTGCAGTGAGCCGG + Intergenic
1093767188 12:22978510-22978532 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1094111253 12:26865185-26865207 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1094112411 12:26875639-26875661 CCCAGGAGGTTGCAGTGAGCTGG - Intergenic
1094172633 12:27509736-27509758 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1094194797 12:27737116-27737138 TCCCGGAGGGTGAGGTGGGAGGG - Intronic
1095359608 12:41320200-41320222 CCAAGGAATGTGAAGTGGGATGG - Intronic
1095478181 12:42607540-42607562 CCCAAAAGGGTGAAGGTGGCAGG + Intergenic
1096046588 12:48567913-48567935 TCCAGGAGTGTGGAGTGGGCAGG + Exonic
1096084355 12:48855663-48855685 CCCAGGAGGCTGAGGTAGGAGGG + Intergenic
1096164942 12:49414708-49414730 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1096190824 12:49617434-49617456 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1096489929 12:52007661-52007683 CCCCGGTGGGAGAAGCGGGCCGG + Intronic
1096757880 12:53815281-53815303 TTCAGGAGGCTGAAGTGGGAGGG - Intergenic
1096857545 12:54495610-54495632 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1096964766 12:55617185-55617207 CCCTGGCGGGTTGAGTGGGCGGG + Intergenic
1096988641 12:55780038-55780060 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1097063875 12:56306004-56306026 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1097142751 12:56916495-56916517 CTCAGGAGGCTGAGGTGGGCGGG - Intergenic
1097797160 12:63875021-63875043 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1097835507 12:64269026-64269048 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1097868102 12:64576741-64576763 CCCAGGAGGCTGAGGTGGGATGG + Intergenic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098529761 12:71528348-71528370 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1098784278 12:74730247-74730269 TGCATGAGGGTGAAGTAGGCAGG - Intergenic
1099230259 12:80015080-80015102 TCCAAGTGGGTGAAGTGTGCTGG + Intergenic
1099718233 12:86325767-86325789 CCCAGGAGGCTGAAGCGGGAGGG + Intronic
1100177878 12:92051388-92051410 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1100836954 12:98575473-98575495 CTCAGGAGGCTGAGGTGGGGAGG - Intergenic
1101039529 12:100740318-100740340 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1101676997 12:106926286-106926308 ACCAGGAGGCTGAGGTGGGAGGG - Intergenic
1101685463 12:107015449-107015471 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101928432 12:108992431-108992453 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1101977636 12:109375258-109375280 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102045532 12:109828006-109828028 CCCCTGAGGGTGGAGTGGCCTGG - Intronic
1102102669 12:110292677-110292699 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1102899721 12:116626894-116626916 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1103349521 12:120274152-120274174 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1103387503 12:120544547-120544569 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1103544535 12:121690541-121690563 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1103755105 12:123198700-123198722 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1103788252 12:123449747-123449769 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
1103994553 12:124820649-124820671 CCCAGGCTGGTGAAGGGGTCTGG - Intronic
1104444819 12:128824288-128824310 CCCGGGAGGCTGAGGTGGGAGGG - Intergenic
1104725731 12:131074625-131074647 CCCAGGGGTGTGACGTGGGGTGG - Intronic
1104836183 12:131793167-131793189 CCCAGGAGGCTGCAGTCAGCCGG - Intronic
1104864146 12:131942854-131942876 CCCAGGGAGGTAAGGTGGGCAGG + Intronic
1104974984 12:132548293-132548315 GCCAGGAGGGTGCCCTGGGCAGG + Intronic
1104988989 12:132614196-132614218 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1105071220 12:133235578-133235600 CCCCGGAGGGTGAGGGGTGCGGG - Exonic
1105941203 13:25149532-25149554 TTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1106177856 13:27346672-27346694 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1106180572 13:27365901-27365923 CTCAGGAGGATGAGGTGGGAGGG - Intergenic
1106507795 13:30386695-30386717 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1107349868 13:39502511-39502533 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1108322674 13:49303179-49303201 CACAGGAGGGTGAGGTTGCCTGG + Intergenic
1109212604 13:59551159-59551181 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1109588796 13:64447521-64447543 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1109645156 13:65244557-65244579 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1109751854 13:66703787-66703809 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1112394138 13:99013209-99013231 CTCAGGAGGCTGAAGCGGGAGGG - Intronic
1112409260 13:99148169-99148191 CTCAGGAGGCTGAAGCAGGCAGG - Intergenic
1113353934 13:109559671-109559693 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1113494783 13:110718306-110718328 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1113672144 13:112182674-112182696 CCCAGGACGGTGAACTGTGCGGG + Intergenic
1113672161 13:112182751-112182773 CCCAGGACGGTGAACTGTGCGGG + Intergenic
1113672178 13:112182828-112182850 CCCAGGACGGTGAGCTGTGCGGG + Intergenic
1113833260 13:113313483-113313505 TCCAGGAGGGGCAAGTGGCCAGG - Intronic
1114232483 14:20796375-20796397 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1115159446 14:30376992-30377014 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1115247401 14:31310275-31310297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1115252468 14:31363870-31363892 CCCAGGAGGCTGAGGTTGGAGGG + Intronic
1115374036 14:32652943-32652965 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1115637534 14:35304968-35304990 CTCAGGAGACTGAAGTGGGAGGG + Intronic
1116857559 14:49966483-49966505 CTCAGGAGGGTGAAAGGGCCAGG - Intergenic
1116879345 14:50148993-50149015 CCCAGGAGGCTGAGGTGGGAAGG - Intronic
1117129736 14:52673843-52673865 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1117371092 14:55078984-55079006 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1117772722 14:59151091-59151113 ACAAGGATGGGGAAGTGGGCAGG + Intergenic
1118202578 14:63690145-63690167 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1118267417 14:64308120-64308142 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1118578137 14:67265446-67265468 CACAGGAGGCTGAGGTGGGAGGG + Intronic
1118903753 14:70008235-70008257 CCCAGGAGGCTGAGGTGAGAGGG - Intronic
1119044237 14:71303561-71303583 CTCAGGAGGTTGAGGTGGGAGGG + Intergenic
1119275397 14:73350637-73350659 CACAGGAGGCTGAGGTGGGAAGG - Intronic
1119523018 14:75300136-75300158 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1119998484 14:79278516-79278538 CCCAGGTGGGTGAAGTCCCCTGG - Intronic
1121047084 14:90796140-90796162 CCCAGAGGGGTTAAGTGGGCCGG - Intronic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1121937305 14:98031837-98031859 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122216773 14:100209723-100209745 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122434967 14:101689178-101689200 CCCAGGCAGGTGGTGTGGGCTGG - Intergenic
1122651419 14:103229075-103229097 CCCAGAAGGATGGAGTAGGCTGG - Intergenic
1123026809 14:105428830-105428852 CTCGGGAGGCTGAAGTGGGGAGG - Intronic
1123046436 14:105519129-105519151 CTCAGGAGGTTGAGGTGGGAAGG + Intergenic
1123509879 15:20987002-20987024 CCCATCAGAGTGAAGTGGGAGGG - Intergenic
1123539109 15:21269863-21269885 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1124341864 15:28894902-28894924 CACAGGAGGGTGGCGGGGGCAGG + Intronic
1124357654 15:29008599-29008621 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1124788800 15:32707262-32707284 CTTGGGAGGCTGAAGTGGGCGGG + Intergenic
1124933620 15:34148478-34148500 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1124965312 15:34429046-34429068 CGCAGGAGGGTGGCGGGGGCAGG - Intronic
1124981928 15:34575248-34575270 CGCAGGAGGGTGGCGGGGGCAGG - Intronic
1125001281 15:34772795-34772817 GCCCGGAGGGAGAAATGGGCTGG + Intergenic
1125493887 15:40171437-40171459 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1125608673 15:40956633-40956655 CCCAGGAGGGGCAGCTGGGCAGG + Intergenic
1125867974 15:43071987-43072009 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1125897041 15:43311177-43311199 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1126034266 15:44532640-44532662 CTCAGGGGGCTGAAGTGGGAGGG - Intergenic
1127082274 15:55392626-55392648 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1127260338 15:57322771-57322793 CCCAGGAGAGTTGAGTGGGCTGG + Intergenic
1127861411 15:62997206-62997228 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1128489192 15:68129168-68129190 CTCAGGAGGGTGAGGTGGGAAGG - Intronic
1128802822 15:70507697-70507719 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1129014342 15:72452523-72452545 CCCGGGAGGCTGAGGTGGGAGGG - Intergenic
1129099880 15:73251403-73251425 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1129776914 15:78242929-78242951 CTCAGGAGGCTGAAGCGGGGAGG + Intronic
1129786253 15:78312145-78312167 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1130036414 15:80365510-80365532 CCCAGCAGGCTTAAGTGTGCAGG - Intronic
1130308976 15:82736060-82736082 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1130377561 15:83343100-83343122 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1130857813 15:87856875-87856897 CTCAGGAGGCTGAAGCAGGCAGG + Intergenic
1131110484 15:89761601-89761623 CCCAGGCTGGTGACCTGGGCCGG - Intronic
1131114734 15:89787721-89787743 CTCAGAAGGCTGAAGTGGGAGGG + Intronic
1131157810 15:90085540-90085562 CACAGGAGGGTGAAGAGACCTGG - Intronic
1131183956 15:90259280-90259302 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1131223516 15:90605142-90605164 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1131240927 15:90742741-90742763 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG + Intergenic
1132427137 15:101727310-101727332 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1132471882 16:109074-109096 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1132641458 16:980371-980393 CCCAGGTGGGTGCGGTGCGCTGG + Intronic
1132807973 16:1784196-1784218 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1132914280 16:2334145-2334167 CCCGGGAGGGTGATGGGGGGAGG + Intronic
1132948864 16:2549025-2549047 CTCAGGAGGCTGAGGTGGGGGGG - Intronic
1132965723 16:2653102-2653124 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
1133061117 16:3175142-3175164 CCCACCAGGGGGAGGTGGGCTGG - Intergenic
1133173741 16:3998301-3998323 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1133209959 16:4258024-4258046 CCCAGAAGGGAGAGGAGGGCTGG + Exonic
1133223291 16:4328340-4328362 CCCGGCTGGGTGAAGGGGGCAGG - Intronic
1133354596 16:5126689-5126711 CCCTGGAGGTTGAAGTGGGAGGG + Intergenic
1133435919 16:5779618-5779640 CCCAGGAGAATGAAGAGGGAAGG - Intergenic
1133447282 16:5872626-5872648 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1133539325 16:6733648-6733670 CTCAGGAGGCTGAGATGGGCAGG + Intronic
1133932939 16:10247088-10247110 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1134049551 16:11127760-11127782 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134173129 16:11984762-11984784 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1134406100 16:13960004-13960026 GCCATGAGGGTGGAGTGGCCCGG + Intergenic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134621962 16:15696265-15696287 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134635961 16:15792164-15792186 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135088769 16:19495602-19495624 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135202502 16:20450642-20450664 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1135216602 16:20577224-20577246 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1135344363 16:21676033-21676055 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1135588772 16:23690821-23690843 CACAGGGAGGTGAGGTGGGCTGG - Exonic
1135645707 16:24159875-24159897 CCCAGGAGGCTGTGGTGGGAGGG + Intronic
1135661864 16:24303808-24303830 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135755788 16:25096806-25096828 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1135927470 16:26708182-26708204 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136073460 16:27802760-27802782 CTCTGGAGGCTGAAGTGGGAGGG - Intronic
1136079128 16:27840135-27840157 CTCAGGAGGGTAAAGTGAGAGGG - Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136126554 16:28186778-28186800 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1136137254 16:28264019-28264041 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136137454 16:28265309-28265331 CTCAGGAGGTTGAGGTGGGAGGG + Intergenic
1136143789 16:28303620-28303642 CTCAGGAGACTGAAGTGGGAGGG - Intronic
1136242931 16:28955704-28955726 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1136457904 16:30392392-30392414 CTCGGGAGGCTGAGGTGGGCAGG - Intronic
1136468145 16:30459315-30459337 CCCAGGAGGCTGAAGTGGGAGGG - Intergenic
1136521468 16:30799112-30799134 CTCGGGAGGATGAAGTGGGAGGG - Intergenic
1136543664 16:30943295-30943317 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1137361298 16:47818178-47818200 CTCTGGAGGCTGAAGTGGGAGGG + Intergenic
1137514317 16:49129903-49129925 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1137600067 16:49750388-49750410 CCCAGGTGGGGGAAGTGGGCTGG + Intronic
1137603880 16:49774402-49774424 ACCAGGAGGGGGAGGTGGGCAGG + Intronic
1137728726 16:50674355-50674377 CTCAGGAGGCTCAGGTGGGCAGG - Intronic
1137813051 16:51371268-51371290 CTCAGGAGAGTGAGGTGGGAAGG + Intergenic
1138188888 16:54998219-54998241 CCCAGGAGCCTGAGGTGGGCAGG - Intergenic
1138218298 16:55225011-55225033 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1138278290 16:55752397-55752419 GCAAGGAGGGGGAAGTGAGCAGG - Intergenic
1138514724 16:57529633-57529655 CCCAGGCGGGGGCACTGGGCTGG + Intronic
1138686360 16:58729417-58729439 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1138831518 16:60380633-60380655 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1139466362 16:67156106-67156128 CACAGGAGGCTGAAGCGGGTTGG - Intronic
1139633325 16:68243757-68243779 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1139779357 16:69338182-69338204 CACAGGAGGTTGAGGTGGGGGGG - Intronic
1140175790 16:72658414-72658436 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1140598624 16:76447200-76447222 CTCAGGAGGTTGAGGTGGGAGGG + Intronic
1140713692 16:77702280-77702302 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1140759666 16:78099643-78099665 CCCTGGAGGGCGCAGTGCGCAGG + Exonic
1140967276 16:79978969-79978991 CCAAGGAGGCTGCAGTGTGCTGG - Intergenic
1141491547 16:84377324-84377346 GCCTGGAAGGTGGAGTGGGCCGG + Intronic
1141834396 16:86529156-86529178 CCTAGGTGGGTGCTGTGGGCAGG - Intergenic
1142016264 16:87749689-87749711 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1142052186 16:87965887-87965909 TCCAGGAGGGCGGAGTGGACAGG + Intronic
1142395890 16:89831301-89831323 CCAATCAGGGTGAAGAGGGCAGG - Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142746297 17:1960406-1960428 CTCACGAGGGCGACGTGGGCTGG - Intronic
1142761936 17:2047686-2047708 CTCAGGAGGCTGAAGCGGGAGGG - Intergenic
1142774877 17:2129216-2129238 CTCAGGAGGGTGAGGTGGGAGGG + Intronic
1142781264 17:2182893-2182915 GCCAGGGGGGTGGGGTGGGCAGG + Intronic
1142977727 17:3655765-3655787 CCCAGGAGGCCGACGTGGCCAGG - Intronic
1143328957 17:6120215-6120237 CTCGGGAGAGGGAAGTGGGCAGG - Intronic
1143405544 17:6675050-6675072 CCAAGGAGTGTGAAGGGGCCAGG + Intergenic
1143528724 17:7488073-7488095 CCCAAGAGGCTGCAGTGAGCTGG - Intronic
1143613166 17:8032146-8032168 CTCAGGAGGGTGAGGTAGGAAGG + Intergenic
1143774308 17:9187721-9187743 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1143879195 17:10016840-10016862 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1144007775 17:11116675-11116697 CCCAGGAGGCTGAGGTGGGCAGG - Intergenic
1144309019 17:13995216-13995238 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1144368524 17:14568437-14568459 CCCAGAAAGTAGAAGTGGGCAGG - Intergenic
1145225032 17:21121348-21121370 CCTGGGAGGCTGAAGTGGGAGGG + Intergenic
1145410619 17:22658423-22658445 CTCAGGAGGCTGATGTGGGAGGG - Intergenic
1145902379 17:28497182-28497204 CCCAGGAGGGGAAAGAGTGCAGG - Exonic
1146259171 17:31410608-31410630 CCGAGGGGGCTGAAGGGGGCGGG + Intronic
1146438054 17:32869823-32869845 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1146479766 17:33195818-33195840 CCCAGGAGGGTGAGGAGGGGAGG - Intronic
1146494940 17:33313216-33313238 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1146863002 17:36321448-36321470 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1147093331 17:38125531-38125553 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1147103876 17:38194957-38194979 CTCAGGAGGCTGAAGTGGGAAGG - Intergenic
1147138540 17:38448924-38448946 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1147183935 17:38703896-38703918 CCCAGGAGGGGGGAGTAGGGCGG - Intergenic
1147630567 17:41928029-41928051 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1147697068 17:42363549-42363571 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1147777922 17:42916468-42916490 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1147957394 17:44143707-44143729 CTCAGGAGGTTGAGGTGGGAGGG + Intronic
1147992313 17:44342157-44342179 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148121431 17:45214574-45214596 CTCAGGAGGCTAAAGTGGGAGGG - Intergenic
1148150008 17:45391378-45391400 CTGAGGAGGGTGTAGGGGGCAGG + Intergenic
1148180909 17:45604096-45604118 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1148267998 17:46241820-46241842 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1148372668 17:47112418-47112440 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148425615 17:47593449-47593471 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1148464419 17:47856467-47856489 TCCAGGAGGGTGAAGAGGGTAGG + Intergenic
1148625118 17:49063245-49063267 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1148761621 17:50005364-50005386 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1149125128 17:53220517-53220539 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
1149291577 17:55223242-55223264 CTCAGGAGGCTGAAGTGGAAGGG - Intergenic
1149632726 17:58140340-58140362 CTCAGGAGGCTGAAGAGGGAGGG - Intergenic
1149897554 17:60440762-60440784 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1150069264 17:62138213-62138235 CCCAGGTGGTTGAAGTGCGGCGG + Intergenic
1150240989 17:63632382-63632404 CTCAGGAGGCTGATGTGGGAAGG + Intronic
1150470694 17:65434925-65434947 CACCGGTGGGTGAAGGGGGCTGG - Intergenic
1150492454 17:65583874-65583896 CCCAGGAGGCTGGTGGGGGCTGG + Intronic
1151173959 17:72271551-72271573 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1151421632 17:74002126-74002148 CCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1151572549 17:74934224-74934246 CTCAGGAGGCTGAAGTGGGGGGG - Intergenic
1151751793 17:76043154-76043176 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1151765839 17:76132743-76132765 CCCGGCAGGGGGCAGTGGGCTGG - Intergenic
1151770047 17:76154835-76154857 CCTAGATGGGTGCAGTGGGCTGG + Intronic
1151840157 17:76611889-76611911 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1151883336 17:76908372-76908394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1151893971 17:76967920-76967942 CTGAGGAGGCTGAAGTGGGAGGG - Intergenic
1151936220 17:77263297-77263319 CCCAGGAGGGATGAGGGGGCAGG + Intergenic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152444073 17:80330476-80330498 GCCAAGAGGGAGAAGCGGGCTGG + Intronic
1152497647 17:80685381-80685403 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1152641412 17:81450799-81450821 CCCAGGAAGCTGAGGTGGGAGGG + Intronic
1152812582 17:82388897-82388919 GCCACGACGGTGAAGTGGGTGGG - Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153566269 18:6421029-6421051 CTCAGGAGGCTGATGTGGGAGGG - Intergenic
1153678010 18:7472765-7472787 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1154029279 18:10737318-10737340 GCCATGAGGATGAAATGGGCAGG + Intronic
1155087955 18:22475859-22475881 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1155480121 18:26277157-26277179 CCCAGGAGGGTCAAGAAAGCAGG - Intronic
1155840012 18:30632352-30632374 GGCAGGAGGGGGAAGTGGGTAGG + Intergenic
1155929737 18:31693858-31693880 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1156351012 18:36300846-36300868 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1156685233 18:39637132-39637154 CACAGTAGGATGAAGTGGGTGGG - Intergenic
1157242530 18:46024509-46024531 ACCAGGAGGTTGAAGTATGCTGG - Intronic
1158030896 18:52963515-52963537 CACAGGAGTCTGAAGTGGTCAGG + Intronic
1158648023 18:59264745-59264767 CTCAGGAGGGTGATCCGGGCTGG - Intergenic
1159549208 18:69877369-69877391 TCCTGGAGGGTGATGTGGACAGG - Intronic
1159556471 18:69951072-69951094 CCCAGGAGGCTGAAGTGGGAGGG - Intronic
1160061750 18:75535200-75535222 CCCAGGAGAAGGAAATGGGCTGG + Intergenic
1160273241 18:77407314-77407336 TCCAGGAGGGTGTTGTGGGGAGG + Intergenic
1160492271 18:79348369-79348391 CCCAGGAGGAACAAGTGTGCAGG - Intronic
1160577184 18:79863483-79863505 CGGAGGAGTGGGAAGTGGGCGGG + Intergenic
1160726874 19:621248-621270 CCCAGGTGGTTGAAGTGCGGCGG + Exonic
1160827594 19:1088015-1088037 CCCAGGAGCACGAAGTGGGAGGG + Exonic
1160943905 19:1632373-1632395 CCCAGGAGCCTGAGCTGGGCCGG + Exonic
1161093970 19:2377980-2378002 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1161164853 19:2780976-2780998 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1161296386 19:3522670-3522692 CCCAGGAGGGAGGCGGGGGCTGG - Intronic
1161804559 19:6435114-6435136 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1161974669 19:7601633-7601655 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162056314 19:8066141-8066163 CCCTGGAGGGTCTAGAGGGCCGG - Exonic
1162245187 19:9394091-9394113 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1162460955 19:10813716-10813738 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162540276 19:11291446-11291468 CCCAGGAGGGTGAGGTTGCAGGG + Intergenic
1162559990 19:11411501-11411523 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162752938 19:12839798-12839820 CTCAGGAGGGTGAGGTGAGGCGG + Intronic
1162770706 19:12948005-12948027 CCAAGGTGGGTGACGTGTGCTGG + Exonic
1163090838 19:15019054-15019076 CTCAGGAGGCTGAGGTGGGGGGG - Intronic
1163383054 19:16981251-16981273 CTCAGGGGGCTGAAGTGGGAGGG + Intronic
1163794599 19:19330053-19330075 CCCAGGAGGCAGAAGTGGCAGGG - Intronic
1163816217 19:19466050-19466072 CCGAGGAGGGTGCCCTGGGCTGG - Intronic
1164431882 19:28196073-28196095 CCCAGGAGGCTGACCTGGGCAGG - Intergenic
1164561288 19:29293950-29293972 CCCAGTAGGGAAAAGAGGGCAGG + Intergenic
1164860912 19:31561578-31561600 CTCGGGAGGCTGAGGTGGGCGGG - Intergenic
1164936243 19:32216790-32216812 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165477766 19:36041202-36041224 CTCGGGAGGCTGAAGTGGGAGGG + Intronic
1165641532 19:37392495-37392517 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1165682177 19:37787213-37787235 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
1165684791 19:37810075-37810097 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1165911455 19:39230939-39230961 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1165927205 19:39334373-39334395 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1165990682 19:39811054-39811076 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
1166294307 19:41881456-41881478 CCCAGGTGTGGGGAGTGGGCAGG - Intergenic
1166312058 19:41968566-41968588 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1166685816 19:44795407-44795429 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1166704697 19:44902308-44902330 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1166723963 19:45014275-45014297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1166798493 19:45442206-45442228 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1167000321 19:46741906-46741928 CCCAGGAAGCTGAAGTGGGCAGG + Intronic
1167016559 19:46844690-46844712 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1167506734 19:49874832-49874854 CCCACCAGGGTGAAGGGAGCAGG + Intronic
1167685447 19:50953019-50953041 CCCAGGAGGAGGCAGTGGCCAGG - Exonic
1167750772 19:51378979-51379001 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1168557329 19:57354115-57354137 CTCAGGAGGGTGAGGTGGGGGGG - Intronic
925296129 2:2778814-2778836 GCCAGAGGGGTGAGGTGGGCAGG - Intergenic
925640123 2:5979160-5979182 CCCAGGAGGGTGGCTTGGGAAGG + Intergenic
925912420 2:8582480-8582502 CCCAGGAGGCTGCAGGGAGCTGG + Intergenic
926000758 2:9330406-9330428 CTCAGGAGGGTGAAGGGAGTGGG + Intronic
927135754 2:20095236-20095258 CCCAGGAGGGTGAAGTTGGTAGG - Intergenic
927609541 2:24524399-24524421 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
927748125 2:25641503-25641525 CTCAGGATGCTGAAGTGGGAGGG - Intronic
927749822 2:25657610-25657632 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
928004169 2:27548498-27548520 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
928640139 2:33289606-33289628 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
928949894 2:36805194-36805216 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
929340967 2:40816959-40816981 CCAAGGAGGGCGAAAGGGGCAGG - Intergenic
929664811 2:43825680-43825702 CCCAGGAGGTTGCAGAGAGCTGG - Intronic
929864770 2:45708771-45708793 CCCAGGAGGTTTTTGTGGGCTGG - Intronic
929867446 2:45730258-45730280 CCCAGGAGGCTGAGATGGGAGGG - Intronic
929909623 2:46078430-46078452 CTCAGAAGGCTGAAGTGGGAGGG + Intronic
930060354 2:47283507-47283529 CCAAGGAGGGTGAAATAGGAGGG + Intergenic
930772474 2:55141711-55141733 CCCAGGAGGGTAAAGTGCTCTGG - Intergenic
931017282 2:57997785-57997807 CTCAGGAGGCTGAAGTGGGTGGG + Intronic
931400981 2:61931202-61931224 CTCAGGAGGCTGAAGTGAGAGGG + Intronic
931432116 2:62216511-62216533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
932413937 2:71562672-71562694 CCCAGGAGTGTGAGAAGGGCAGG + Intronic
933030803 2:77326499-77326521 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934062718 2:88310359-88310381 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
934138517 2:89020792-89020814 CCCTGGTGGGTGCAGTGGGGTGG + Intergenic
934144602 2:89078893-89078915 CCCTGGTGGGTGCAGTGGGGTGG + Intergenic
934149250 2:89129591-89129613 CCCTGGTGGGTGCAGTGGGGTGG + Intergenic
934218042 2:90052451-90052473 CCCTGGTGGGTGCAGTGGGGTGG - Intergenic
934224650 2:90121656-90121678 CCCTGGTGGGTGCAGTGGGGTGG - Intergenic
934230726 2:90179760-90179782 CCCTGGTGGGTGCAGTGGGGTGG - Intergenic
934534182 2:95119502-95119524 CACAGGAGGCTGAAGTGGGAGGG + Intronic
934764406 2:96872405-96872427 CTCAGGAGGCTGGAGTGGGAGGG + Intergenic
934961202 2:98675653-98675675 CTCAGGAGGCTGAGGTGGGGAGG - Intronic
935033706 2:99347111-99347133 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
935120507 2:100179920-100179942 GGCAGAAGGGTGAAGTTGGCTGG + Intergenic
935229142 2:101080881-101080903 CTCAGGAGGCTGAGGTGGGACGG - Intronic
935444921 2:103146185-103146207 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
935602849 2:104940201-104940223 CCCTGGAGGGTGAATTGTGCGGG - Intergenic
936169896 2:110161056-110161078 CTCAGGAAGCTGAAGTGGGAGGG + Intronic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
936679635 2:114755400-114755422 CTCTGGAGGGTGAAGCGGGGAGG - Intronic
936811980 2:116413469-116413491 CCCAGGAGAGGCAAGTGGACAGG - Intergenic
937239300 2:120450088-120450110 CCAAGGAGGTTGAAGCAGGCCGG + Intergenic
937942619 2:127297806-127297828 CCCAGGAGGCTGAGGTGGGTGGG - Intergenic
938004127 2:127773869-127773891 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
938482150 2:131671673-131671695 CTCAGGAGGCTGAAGTGAGAGGG + Intergenic
938714369 2:134006064-134006086 TTCAGGAGGCTGAGGTGGGCTGG - Intergenic
938788963 2:134659827-134659849 CCAAGGAGGCTGAAGAGGGAGGG + Intronic
938916539 2:135946887-135946909 CTCAGGAGTCTGAAGTGGGAGGG - Intronic
940807229 2:158201515-158201537 CTCAGGAGGCTGAGGTGGGACGG - Intronic
940878763 2:158924660-158924682 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
941068700 2:160932030-160932052 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
941101992 2:161307061-161307083 CCTAGGAGGCTGAAGTGGGAGGG + Intergenic
942082274 2:172411938-172411960 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
942247324 2:174019641-174019663 CTCAGGAGGCTGAGGTGGGGGGG + Intergenic
942457536 2:176148373-176148395 CATAGGAGGGTGGAGTGGGGTGG + Intergenic
942737997 2:179138761-179138783 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
943184289 2:184586707-184586729 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
943895175 2:193348246-193348268 TCATGGAGGGTGCAGTGGGCGGG + Intergenic
944162568 2:196680407-196680429 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
944194448 2:197037832-197037854 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
944708157 2:202311744-202311766 CTCAGGAGGGTGAGGTAGGAGGG + Intergenic
945074813 2:206027594-206027616 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
945259669 2:207831906-207831928 CCCAGCAGGGGAAAGGGGGCTGG - Intronic
945293042 2:208144509-208144531 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
946838929 2:223800422-223800444 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
946968822 2:225069114-225069136 CCCAGGAGAGTGAAGTGAATGGG - Intergenic
947707397 2:232287504-232287526 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
947789720 2:232857983-232858005 TACAGGAGGATGCAGTGGGCTGG + Exonic
948139108 2:235659919-235659941 CCCAGGCTGGTGGGGTGGGCAGG + Intronic
948261603 2:236607955-236607977 CCCAGGGGGGTGTGCTGGGCGGG + Intergenic
948263880 2:236623770-236623792 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
948548301 2:238748622-238748644 CCCAGCAGCCTGAAGTTGGCGGG - Intergenic
948663972 2:239523248-239523270 GCCACGAGGGTGCAGTGGGGAGG + Intergenic
948672146 2:239575416-239575438 CCCAGGAGAGTGAGGTGGACAGG + Intergenic
948760472 2:240187226-240187248 CCAAGGTGGGGGAAGTGGGGTGG + Intergenic
948805582 2:240452466-240452488 CCCCGGAGGGTAATGGGGGCGGG - Intronic
948835127 2:240622748-240622770 CCCAGCGGGGTGAAGTGGGAGGG + Intronic
949079019 2:242081941-242081963 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1168770821 20:415258-415280 CCCAGGAGGCTGAGGTGGGAGGG + Intronic
1168787925 20:556097-556119 GCCAGGAGAGACAAGTGGGCGGG + Intergenic
1168819583 20:763906-763928 ACCAGGGGTGAGAAGTGGGCGGG + Exonic
1169129105 20:3154573-3154595 CTCAGGAGGTAGAAGTGGGAAGG + Intronic
1169960920 20:11159358-11159380 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1169992940 20:11523688-11523710 CCCAGGAGAGAGATTTGGGCTGG + Intergenic
1170683817 20:18550715-18550737 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1170811971 20:19681155-19681177 CCCAGCAGGCTGAGGTGGGAAGG - Intronic
1171246379 20:23613327-23613349 CCCAAAAGGGTGATGTGGGTTGG + Intergenic
1171273549 20:23835223-23835245 TCCAGGAGGGAGACGTGGGTTGG + Intergenic
1171398050 20:24852060-24852082 CTCAGGAGGCTGAAGTGAGAGGG + Intergenic
1171963281 20:31510722-31510744 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
1172063321 20:32202110-32202132 AGCAGGAGGAGGAAGTGGGCTGG - Exonic
1172466049 20:35155262-35155284 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1172494717 20:35371906-35371928 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172776932 20:37413413-37413435 CGCAGGAGGGTGCAGGGGGGCGG - Intergenic
1173164042 20:40673755-40673777 CCCAGGAGGTGTAAGGGGGCTGG - Intergenic
1173198180 20:40933156-40933178 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1173573173 20:44091361-44091383 CCCAGGCAGGTGGAGTGGGAAGG - Intergenic
1174201660 20:48810474-48810496 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1174295964 20:49545309-49545331 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1174554058 20:51381508-51381530 CCCAGCAGGGTGCAGAGGGAGGG - Intergenic
1175047375 20:56119803-56119825 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1175196901 20:57250421-57250443 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1175264507 20:57694564-57694586 CACAGATGGGTGCAGTGGGCTGG + Intronic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175998187 20:62820658-62820680 CCCAGGGGTGTGGGGTGGGCTGG + Intronic
1176141734 20:63547819-63547841 CCGAGGAGGGCGGGGTGGGCAGG + Intergenic
1176199376 20:63853691-63853713 ACCAGGAGGGTGAAGGCGGCTGG - Intergenic
1176385469 21:6136828-6136850 CCCTGGAGCGTGGAGAGGGCAGG - Intergenic
1176413608 21:6462056-6462078 TGCTGGAGGGTGGAGTGGGCAGG - Intergenic
1177819139 21:26012113-26012135 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1178021606 21:28414771-28414793 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1178331605 21:31700066-31700088 CCCAGGATGCTGAGGTGGGTGGG - Intronic
1178430760 21:32516918-32516940 CCCAGCTGTGTGACGTGGGCTGG - Intergenic
1178508423 21:33181863-33181885 CCCAGGAGGGGGAAGTTGTTGGG - Intergenic
1178976921 21:37228079-37228101 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1178991763 21:37362742-37362764 CCCAGGAGACTGAGGTGGGGAGG + Intergenic
1179210917 21:39323552-39323574 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1179550855 21:42142450-42142472 CCCAGGAGGGTTCTGAGGGCTGG - Exonic
1179627773 21:42658263-42658285 CCCAGCAGGGTGCAGAGGCCTGG - Intronic
1179689106 21:43070379-43070401 TGCTGGAGGGTGGAGTGGGCAGG - Intronic
1179738004 21:43401424-43401446 CCCTGGAGCGTGGAGAGGGCAGG + Intergenic
1180014231 21:45072508-45072530 CCCAGGAGGGTGAGATGGCCGGG - Intergenic
1180195227 21:46190031-46190053 CCCAGGTGGGTGCTCTGGGCTGG - Exonic
1180216339 21:46325378-46325400 CCCAGGAGGGTGGAGGGGGGAGG + Intronic
1180615665 22:17124264-17124286 CCCAGGAGGCTAAAGTGGGAGGG + Intronic
1180797620 22:18614268-18614290 CCCAGGAGGCTGAGATGGGAGGG + Intergenic
1180817325 22:18799214-18799236 CTCAGGAGGCTGATGTGGGAGGG - Intergenic
1180998306 22:19976375-19976397 CCCATGAGGGTGAGCAGGGCAGG - Intronic
1181102074 22:20547889-20547911 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1181203515 22:21233535-21233557 CTCAGGAGGCTGATGTGGGAGGG - Intergenic
1181224098 22:21380994-21381016 CCCAGGAGGCTGAGATGGGAGGG - Intergenic
1181254535 22:21553829-21553851 CCCAGGAGGCTGAGATGGGAGGG + Intronic
1181433109 22:22894825-22894847 GCCAGGAGAGCCAAGTGGGCTGG + Intronic
1181719909 22:24766059-24766081 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1181836130 22:25610357-25610379 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1182258031 22:29051929-29051951 CCCAGGAGGCTGAAGTGCAAGGG - Intronic
1182448002 22:30400785-30400807 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182454389 22:30440452-30440474 CCCATGAGAGGGAAGTGGGCAGG + Intergenic
1182461238 22:30485510-30485532 ACCAGGAGCGTGAACTGGGGTGG - Intergenic
1182469809 22:30541723-30541745 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182496449 22:30711630-30711652 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1183159094 22:36098897-36098919 CCCAGGAGGTTGCAGTAAGCCGG - Intergenic
1183336527 22:37250739-37250761 CTCAGGAGGCTAAGGTGGGCAGG + Intergenic
1183419160 22:37700522-37700544 CTCAGGAGGCTGAAGTTGGGAGG - Intronic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1183606002 22:38866985-38867007 CCGAGAAGGGCGAAATGGGCGGG + Exonic
1183726881 22:39594781-39594803 CCCCGGATGTTGGAGTGGGCAGG + Intronic
1183897013 22:40977562-40977584 CCCAGGAGGCTGAAGTGCAGTGG + Intergenic
1184095769 22:42315456-42315478 CCCAGGCAGGTGGAATGGGCTGG + Intronic
1184208984 22:43024177-43024199 CCCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184475042 22:44715758-44715780 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1184767996 22:46581989-46582011 CCCAGGTGGGTGGAGAGGCCTGG + Intronic
1184836658 22:47027889-47027911 CCCAGGGGGGAGGAGTGGGCTGG - Intronic
1185130198 22:49034715-49034737 CCCAGGAGGGAGAGATTGGCCGG - Intergenic
949380621 3:3441398-3441420 CTCAGGAGGCTAAAGTGGGAAGG + Intergenic
949569708 3:5281227-5281249 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
949864832 3:8538830-8538852 CCCAGGACGGTGCAGGGTGCAGG + Intronic
950024332 3:9810184-9810206 CCCAGGAGGCTGCCATGGGCCGG + Exonic
950036014 3:9886237-9886259 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
950064384 3:10100078-10100100 CACAGGAGGCTGAGGTGGGAGGG + Intronic
950460909 3:13121789-13121811 CCCAGGATGGGGCAGTGGGCTGG + Intergenic
950578178 3:13845675-13845697 CCCAGGAGTGTACAGGGGGCAGG - Intronic
951111094 3:18805118-18805140 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
951402802 3:22254969-22254991 CCCAGGAGGATGAAGCAGGATGG + Intronic
951489628 3:23255189-23255211 CCTAGGAGGCTGATGTGGGAGGG - Intronic
951528620 3:23678259-23678281 CCCAGGAAGGTGAGCAGGGCTGG - Intergenic
952007735 3:28861412-28861434 CCCAGGGAGGTGAAGTGGGCTGG + Intergenic
952061582 3:29517103-29517125 CCCAGGAGGCTGAGATGGGAGGG + Intronic
952311356 3:32193315-32193337 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
952371352 3:32726050-32726072 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
952428849 3:33202502-33202524 ACTAAGAAGGTGAAGTGGGCTGG + Intronic
952811706 3:37410192-37410214 TTCAGGAGGCTGAAGTGGGAGGG + Intronic
953341347 3:42136514-42136536 CTCAGGAGGCTAAGGTGGGCGGG + Intronic
953578011 3:44128688-44128710 CACAGGGTGGTGAAGTGTGCAGG + Intergenic
953653968 3:44833273-44833295 ACCAGGAGTGTGAGGGGGGCTGG + Intronic
953756016 3:45646440-45646462 CACATGAAGGTCAAGTGGGCTGG - Intronic
954040420 3:47882680-47882702 CTCAGGAGGCTGAAGACGGCAGG - Intronic
954180903 3:48880684-48880706 CTCAGGAGGTTGAGGTGGGAAGG - Intronic
954239927 3:49285536-49285558 CTCAGGAGGGTGAGGTGGGAAGG + Intronic
954393810 3:50281784-50281806 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
954633137 3:52057505-52057527 CCCAGGGCGGGGAAGTGGGCGGG + Intergenic
954789138 3:53117995-53118017 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
954923184 3:54209327-54209349 GCCAGGAGGGTGAGGCTGGCTGG - Intronic
955239437 3:57165871-57165893 TCCAGGAGGGTGAGGGGGACGGG - Intronic
955404814 3:58619432-58619454 CCTACGAGGCTGAAGAGGGCTGG + Intronic
955773612 3:62410995-62411017 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
956457484 3:69437178-69437200 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
956715339 3:72074927-72074949 CTCAGGAGGCTGAATTGGGAAGG - Intergenic
957055807 3:75442110-75442132 CCCAGCAGGTTGGAGTGCGCTGG + Intergenic
957058484 3:75462374-75462396 CCCTGGAGGTTGAAGTGGGAGGG + Intergenic
957634949 3:82770438-82770460 CTCAGGAGGGAAAAGAGGGCTGG - Intergenic
957902030 3:86506878-86506900 CTCAGGAGGGAGAGCTGGGCTGG - Intergenic
958132028 3:89439348-89439370 CTCAGGAGGCTGACGTGGGAGGG + Intronic
959586549 3:108030556-108030578 CTCAGGAGGATGAGGTGGGAGGG + Intergenic
960230731 3:115223612-115223634 CTCAGTAGGCTGAAGTGGGGGGG - Intergenic
961048904 3:123729771-123729793 CCCAGGAGGCTGAGGTGGGAAGG + Intronic
961153849 3:124662309-124662331 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
961184129 3:124899744-124899766 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
961294964 3:125877328-125877350 CCCTGGAGGTTGAAGTGGGAGGG - Intergenic
961505204 3:127366135-127366157 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
961512688 3:127412843-127412865 CTCAGGAGGACGAAGTGGGCAGG - Intergenic
961677634 3:128577393-128577415 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
961759263 3:129153539-129153561 TACGGGAGGGTGAGGTGGGCAGG + Intronic
961890940 3:130129836-130129858 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
963299538 3:143583043-143583065 CTCAGGAGGCTGAGGTGGGACGG + Intronic
964446871 3:156768293-156768315 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
965405291 3:168260659-168260681 CTCAGGAAGGTGATCTGGGCTGG + Intergenic
965502270 3:169471097-169471119 CCCTGGAGGCTGAGGTGGGAGGG - Intronic
965596223 3:170413963-170413985 CCCTGGAGGCTGAAGTGTGGCGG - Intergenic
965755281 3:172020133-172020155 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
965923069 3:173943116-173943138 CTCAGGAGGCTGAAGTTGGAGGG + Intronic
966106395 3:176340591-176340613 CTCAGGAGGTTGGAGTGGGAGGG + Intergenic
966158120 3:176940161-176940183 CTCAGGAGGCTGATGTGGGAGGG + Intergenic
967983801 3:195080788-195080810 CCCATGAGGGTGAAGGGCGCTGG - Intronic
968091105 3:195898731-195898753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
968221096 3:196940966-196940988 CTCAGGAGGCTGAGGTGGGTAGG + Intronic
968283193 3:197492468-197492490 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
968347772 3:198025477-198025499 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
968502852 4:959225-959247 CCCAGGAGGCTGCAGCAGGCTGG + Exonic
968812198 4:2805114-2805136 CCCAGGAGGGTCTGGTTGGCGGG + Intronic
969252286 4:5976052-5976074 CCCATGAGGGTAAAGAGGGCAGG - Intronic
969308687 4:6339833-6339855 TCCACGAGGGTGGAGTGGCCTGG + Intronic
969751678 4:9116259-9116281 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
969811591 4:9652558-9652580 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
971329462 4:25670655-25670677 CCCAGGGGGTTGAAGTGAGAGGG - Intronic
971415128 4:26419084-26419106 CTCAGGAGGCTGAGGTGGGACGG - Intronic
972412138 4:38805995-38806017 CCCAGGGGAGGGAAGTGGGCAGG + Intronic
972445139 4:39136567-39136589 CCAAGCAGGGTGAAGAGGGTGGG + Intergenic
972492187 4:39598363-39598385 CTCTGGAGGGAGAAGTGGGTAGG - Intronic
972496993 4:39643332-39643354 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
972524199 4:39892001-39892023 CTCAGGAGGCTGAGGTGGGGGGG + Intronic
972641843 4:40932637-40932659 CACAGGAGGGTGAAGGGGAGGGG + Intronic
972729428 4:41778900-41778922 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
973015008 4:45127066-45127088 CTCAGGAGGCTGAAGTGTGAGGG + Intergenic
973572630 4:52256158-52256180 TACAGGAGGCTGAAGTGGCCAGG + Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
973870306 4:55159558-55159580 CACAGTTGGGTGAAGTGGACTGG - Intergenic
974896762 4:67949614-67949636 TTTAGGAGGCTGAAGTGGGCAGG + Intronic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
976076752 4:81307582-81307604 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
976261098 4:83145676-83145698 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
976709660 4:88055442-88055464 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
976722314 4:88180642-88180664 CTCAGGAGGCTGAGGTGGGGGGG + Intronic
976723272 4:88191167-88191189 CCCAGGAGGCTGGAGTGCACTGG + Intronic
977880123 4:102194664-102194686 CCCAGGAGGATGTAGTAGGAAGG + Intergenic
978718334 4:111873640-111873662 CCCAGGCGGATGAGGTGGGGTGG - Intergenic
978804546 4:112786630-112786652 TTCAGGAGGCTGAGGTGGGCAGG - Intergenic
979140258 4:117163205-117163227 TCCAGGAAGGTGATGGGGGCTGG - Intergenic
982027333 4:151263912-151263934 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
982045910 4:151445449-151445471 CCCAGCAAGGTGGAGTGGGGGGG + Intronic
982360232 4:154511595-154511617 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
982652059 4:158098859-158098881 CTCAGGAGGCTGGAGTGGGAGGG - Intergenic
982652082 4:158099027-158099049 CTCAGGAGGCTGGAGTGGGAGGG - Intergenic
982754311 4:159200358-159200380 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
983902046 4:173146261-173146283 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
984261736 4:177451213-177451235 CTCAGGAGGGTGAGGTGGAAGGG - Intergenic
984471975 4:180187996-180188018 CACAGGAGGATGATGTAGGCTGG + Intergenic
984699500 4:182809565-182809587 CCCAGGAGGGAGAACTGGTGAGG - Intergenic
985299319 4:188471464-188471486 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
985696756 5:1345185-1345207 CCCAGGAGGGCGGCGCGGGCGGG - Intergenic
986132058 5:4941234-4941256 CCCGGTAGGGTGAAGTGGCAAGG - Intergenic
986199739 5:5570135-5570157 CCCAGAATGGGGAAGTGGGCTGG + Intergenic
986224677 5:5801607-5801629 CCAAGGAGGGTGTAGTGGTGAGG + Intergenic
987157798 5:15108600-15108622 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
987340596 5:16936102-16936124 CCCAGGCGGGGGAAGGCGGCGGG + Exonic
987404758 5:17513208-17513230 CCCATGAGGATGAAGTGAACTGG + Intergenic
987412366 5:17626933-17626955 CCCATGAGGATGAAGTGAACTGG + Intergenic
987471710 5:18339012-18339034 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
988136320 5:27175911-27175933 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
988630892 5:32930514-32930536 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
988753341 5:34215738-34215760 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
989174733 5:38512530-38512552 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
989391203 5:40902669-40902691 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
989598454 5:43179913-43179935 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
991715250 5:69445779-69445801 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
991725132 5:69528243-69528265 CTGAGGAGGGTGGAATGGGCAGG + Intronic
991741122 5:69676584-69676606 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
991756496 5:69877858-69877880 CTCAGGTGGCTGAAGTGGGAGGG + Intergenic
991792696 5:70256321-70256343 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
991820582 5:70552657-70552679 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
991835898 5:70753771-70753793 CTCAGGTGGCTGAAGTGGGAGGG + Intergenic
991885146 5:71256629-71256651 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
992009615 5:72513410-72513432 CCCAGGAGTGGTAAGTGGGAGGG + Intergenic
992057802 5:73009642-73009664 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
992137666 5:73763581-73763603 CCCTGGAGAGTCAAGTGGGAGGG + Intronic
992862233 5:80922904-80922926 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
993610906 5:90052995-90053017 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
993818930 5:92589903-92589925 GCCACAAGGGAGAAGTGGGCTGG + Intergenic
994100379 5:95884688-95884710 CCCAGGATGGAGAAGTGGTTAGG + Intergenic
994239784 5:97406973-97406995 CCCAGGGGGCTGAAGTGGCATGG + Intergenic
995306815 5:110661418-110661440 CCCAGGAAGATGAGGTGGGGGGG - Intronic
995348567 5:111149038-111149060 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
995393987 5:111667772-111667794 CCCAGGAGGCTGAGGTGCGAGGG + Intronic
995514232 5:112938446-112938468 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
997110307 5:131067119-131067141 CCCATTAGGGTGAAATGGCCAGG + Intergenic
997195198 5:131974588-131974610 CCCAGGAGGGACAAGTGGGGTGG + Intronic
997496434 5:134330882-134330904 ACCAAGAGGTGGAAGTGGGCTGG - Intronic
997556245 5:134801161-134801183 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
997908184 5:137841397-137841419 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
998236014 5:140399780-140399802 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
999284510 5:150386192-150386214 CCCAGTGGGGTGGCGTGGGCAGG + Intronic
999321041 5:150615233-150615255 GCCAGGAGGGAGGAGTTGGCAGG - Intronic
999698633 5:154207868-154207890 CCCAGGAGCGTGAAGGGTGTTGG + Intronic
1000311637 5:160050731-160050753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000339163 5:160264051-160264073 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000625143 5:163529823-163529845 CTCAGGAAGCTGAAGTGGGGAGG + Intergenic
1000802284 5:165743281-165743303 CTCAGGAGGTTGAGGTGGGAGGG - Intergenic
1001157415 5:169285016-169285038 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1001319238 5:170666810-170666832 TGCTGGAGGGAGAAGTGGGCAGG - Intronic
1001464509 5:171951426-171951448 CTCAGGAGGCTGAAGTGCGAGGG + Intronic
1001607527 5:172972680-172972702 CCCAGGAGGCTGAGGTGGGGAGG + Intergenic
1001750783 5:174129484-174129506 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1001773313 5:174311607-174311629 CCAAGGAGGCTGCCGTGGGCTGG + Intergenic
1001939163 5:175728821-175728843 CCCAAGAGGTGGGAGTGGGCGGG - Intergenic
1002038913 5:176496234-176496256 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1002439038 5:179254587-179254609 CCCAGATGGGTGAAGTCGGGGGG + Intronic
1002464973 5:179403681-179403703 GCCAGGAGGTTGTAGTGGGGAGG + Intergenic
1003458609 6:6308120-6308142 CTCAGGAGGATGAGGTGGGGAGG - Intronic
1004205824 6:13591472-13591494 CCCAGGATGGGGACGTAGGCTGG + Intronic
1004254718 6:14052416-14052438 ACCAGTAGGGATAAGTGGGCCGG - Intergenic
1005294371 6:24410576-24410598 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1005551508 6:26922559-26922581 CTCAGGTGGCTGAAGTGGGAGGG - Intergenic
1005968705 6:30744442-30744464 CCCGGGATGGTGGAGGGGGCCGG + Exonic
1006744290 6:36330555-36330577 TCCTGGAGGGGGCAGTGGGCAGG + Exonic
1006955107 6:37862574-37862596 CTCAGGAGGTTGAGGTGGGCGGG + Intronic
1006964225 6:37965868-37965890 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1007245358 6:40457914-40457936 GCCATGAGGGTCAAGGGGGCTGG + Intronic
1007269153 6:40622826-40622848 CCCAGGAGGATCTAGTGTGCAGG + Intergenic
1007414326 6:41683255-41683277 CCTAGGAGGGGGACATGGGCTGG - Intergenic
1007590617 6:43018591-43018613 GTCAGGAGTGTGAAGAGGGCAGG - Intronic
1007654236 6:43442620-43442642 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1007662290 6:43494365-43494387 CCCATGAAGGTGAAGTGAGAAGG - Intronic
1008439032 6:51511308-51511330 TCCAGGAGGAGGAAGTGGGGAGG - Intergenic
1010149020 6:72708627-72708649 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1010830567 6:80523497-80523519 CGCAGGAGGGTCAGGTGGACAGG + Intergenic
1011621904 6:89251052-89251074 CTCAGGAGGCTGAAGTGGGTGGG - Intergenic
1011746145 6:90409683-90409705 CCCTGAGAGGTGAAGTGGGCAGG + Intergenic
1012282256 6:97342194-97342216 CCCAGGAGGCTGAGGTGGAAGGG + Intergenic
1013828969 6:114250156-114250178 CCCATGATGGTGAAATGGGATGG + Intronic
1013837191 6:114346331-114346353 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1014026006 6:116646680-116646702 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1014539482 6:122656631-122656653 CCCAGGCGGGAGAAGTGAGGGGG + Intronic
1014677445 6:124384733-124384755 CCCAGGAGGCTGAAGTGAGAAGG - Intronic
1014684085 6:124473285-124473307 ACCAGGAAGGTGAGGTGGCCAGG + Intronic
1015297701 6:131616710-131616732 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1015338848 6:132074534-132074556 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1015615530 6:135070537-135070559 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1015624538 6:135166670-135166692 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1016796580 6:148124531-148124553 CCCAGCAGGATGGAGTGGGATGG - Intergenic
1017147364 6:151246867-151246889 CTCAGGAGGCTGAAGTAGGAGGG - Intronic
1017731095 6:157316766-157316788 CACAGGAGGCTGAGGTGGGAAGG + Intronic
1018243156 6:161798347-161798369 CCTAGGAGGGTGGTGTGAGCCGG + Intronic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018867950 6:167759964-167759986 CCCAGGCGGGTGCAGGGGGAAGG + Intergenic
1018911178 6:168101551-168101573 CCCCGGAGGGTGACGCGGCCCGG + Intergenic
1019647810 7:2140348-2140370 CCCTGAAGGGTGAAGGGTGCCGG + Intronic
1019930663 7:4220890-4220912 CTCAGGAGGGTGAGGCGGGGTGG - Intronic
1019937778 7:4267500-4267522 CCGGAGAGGGCGAAGTGGGCGGG + Exonic
1020056717 7:5122661-5122683 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1020089637 7:5331800-5331822 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1020171187 7:5846301-5846323 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1020225654 7:6277948-6277970 TCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1020364989 7:7371559-7371581 CCCAGGTGGGTGAAGGAGGAAGG + Intronic
1021173560 7:17423787-17423809 CACAGAAGGGTGAACTGGGGAGG - Intergenic
1021498562 7:21303838-21303860 CTCAGGAGGCTGAAATGGGAGGG + Intergenic
1021549919 7:21860063-21860085 CCCAAGAGGCTGAGGTGGGAGGG + Intronic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1023830218 7:44034840-44034862 CCCAGGAGGCTGGTGTGGGCTGG + Intergenic
1023925530 7:44666715-44666737 CCCTGCAGGGCGATGTGGGCAGG - Exonic
1024308552 7:47948250-47948272 ACCAGGAGGGTGCATTTGGCCGG - Intronic
1025729235 7:64095572-64095594 CTCAGGAGGCTGATGTGGGAGGG - Intronic
1025843391 7:65173186-65173208 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1025855098 7:65269561-65269583 CCCAAGAGGGGAGAGTGGGCTGG + Intergenic
1025879654 7:65522781-65522803 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1025893783 7:65679807-65679829 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1026093016 7:67317007-67317029 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
1026212362 7:68317035-68317057 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1026214147 7:68333373-68333395 CTTAGGAGGGTGAAGTGGGAAGG - Intergenic
1026350659 7:69512523-69512545 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1026352744 7:69531770-69531792 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
1026885788 7:73943612-73943634 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1026965159 7:74434764-74434786 CCCAGGAAGGTGAGTGGGGCTGG + Intergenic
1026971551 7:74471566-74471588 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1027035839 7:74924610-74924632 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1027137548 7:75635913-75635935 CCCAGGAGGCTGAGGTAGGGAGG + Intronic
1027308685 7:76930047-76930069 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
1027770302 7:82398683-82398705 CTCGGGAGGCTGAAGTGGGAGGG - Intronic
1028129505 7:87152883-87152905 CCCTGGGGGGTGGGGTGGGCCGG + Intronic
1028179959 7:87707564-87707586 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1029087968 7:98026063-98026085 CTCAGGGGGCTGAAGTGGGAGGG + Intergenic
1029164103 7:98573783-98573805 TTTAGGAGGGTGAGGTGGGCGGG + Intergenic
1029192603 7:98782388-98782410 CCCGGGAGGCTGAGGTGGGAGGG + Intergenic
1029446394 7:100615200-100615222 CCAGGGAGGGTGGGGTGGGCTGG - Exonic
1029454810 7:100663907-100663929 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1029579673 7:101427303-101427325 CTCAGGAGGCTGAAGTGGAATGG - Intronic
1029714692 7:102319565-102319587 CCCAGGAGGGGGAGCTGGTCTGG - Intronic
1029735396 7:102463063-102463085 CCCAGGAGGCTGAGGTGGGAGGG - Intronic
1029740536 7:102489127-102489149 CCCAGGAGGCTGGTGTGGGCTGG + Intronic
1029758533 7:102588299-102588321 CCCAGGAGGCTGGTGTGGGCTGG + Intronic
1029776471 7:102687378-102687400 CCCAGGAGGCTGGTGTGGGCTGG + Intergenic
1030037729 7:105422300-105422322 CTCATGAGGGTGAAGTCGTCAGG - Intergenic
1030554246 7:111003617-111003639 CCCAGGAGGCTAAGGTGGGAAGG - Intronic
1030844309 7:114390660-114390682 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1031008384 7:116499555-116499577 CCCCGGCGGGGGAGGTGGGCGGG + Exonic
1031038438 7:116813791-116813813 CTCAGGAGGCTGAAGTGAGAGGG - Intronic
1032078729 7:128848320-128848342 CCCAGGAAGGTGCTGTGGGAGGG - Intronic
1032106592 7:129036322-129036344 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1032165092 7:129539275-129539297 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1032174528 7:129612212-129612234 CCCGGGAGCGGGAGGTGGGCGGG + Intronic
1032197242 7:129796489-129796511 CCCAGGTGGCTGGAGTGGGAGGG - Intergenic
1032301373 7:130690596-130690618 CTCAGGAGGCTGAGGTGGGTGGG - Intergenic
1032727213 7:134601630-134601652 CCCAGGGGGCTGAGGTGGGAGGG + Intergenic
1033768630 7:144523289-144523311 CTCGGGAGGCTGAAGTGGGAGGG - Intronic
1034100853 7:148449230-148449252 CCCATGAAGGTGAAGGGGTCTGG - Intergenic
1034132827 7:148736413-148736435 CTCAGGAGGTTGAGGTGGGGTGG - Intronic
1034440358 7:151082937-151082959 CACACTGGGGTGAAGTGGGCAGG - Exonic
1034447515 7:151121158-151121180 GCCGGGAGGGAGAAGTGAGCTGG - Intronic
1034519041 7:151604529-151604551 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1035069387 7:156130527-156130549 CCCAGGTGGGGGGAGTGGGGAGG - Intergenic
1035132626 7:156669697-156669719 CCAAAGAGGGTGAAGAGGGCAGG + Intronic
1035856105 8:2978210-2978232 CCCAGGTGGGCGAAGTGCTCTGG - Intronic
1036153762 8:6323300-6323322 CCCAGGTGGCTGAAGTGGGAGGG - Intergenic
1036354630 8:8033784-8033806 CCCAGTTGGGTCAAGGGGGCTGG - Intergenic
1036374890 8:8191690-8191712 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1036577730 8:10044350-10044372 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1036773200 8:11592727-11592749 CCCAGGAGGGTGAGGTTAGGTGG + Intergenic
1036876012 8:12473954-12473976 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1037420229 8:18694196-18694218 CTCAGGTGGGTGTGGTGGGCAGG - Intronic
1037459728 8:19096998-19097020 CTCAGGAGGCTGAGGTGGGGGGG - Intergenic
1037613086 8:20492953-20492975 ACCAGGAGGGAGAGGTGGGGAGG - Intergenic
1037805356 8:22055563-22055585 GCCAGGAGAGTGATGTGGGAGGG - Intronic
1037892768 8:22632348-22632370 CCCAGGAGGGTGCTCCGGGCTGG - Intronic
1038258122 8:25969810-25969832 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1038258275 8:25970938-25970960 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1038328047 8:26587369-26587391 GCCAGGAGGGTGGAGTGCCCAGG - Intronic
1038333097 8:26624933-26624955 CCCAGGAAGATGATGTGGCCTGG - Intronic
1038355773 8:26827999-26828021 CTCAGGAGGTTGAGGTGGGAGGG - Intronic
1038504249 8:28070882-28070904 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1038543721 8:28410079-28410101 CTCGGGAGGGTGAGGTGGGAGGG + Intronic
1038695462 8:29802422-29802444 GATAGGAGGATGAAGTGGGCAGG + Intergenic
1038843427 8:31206915-31206937 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1038982939 8:32778967-32778989 CTCAGGAGGATGAAGTGGGAGGG + Intergenic
1039133517 8:34294658-34294680 CCCAGTAGGGTGGGCTGGGCAGG - Intergenic
1039434310 8:37549097-37549119 TCCAGAAGGGTGAAGTGCCCAGG - Intergenic
1039702934 8:39979927-39979949 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1039812464 8:41061774-41061796 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1040901379 8:52420114-52420136 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1041120066 8:54577256-54577278 TCCGGGAGGCTGAGGTGGGCAGG - Intergenic
1041281091 8:56211592-56211614 CCGAGGCGGGAGGAGTGGGCGGG - Intergenic
1041704554 8:60832127-60832149 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1041731885 8:61070730-61070752 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1041904349 8:63015011-63015033 GCAAGGAGGATGGAGTGGGCAGG + Intergenic
1042251024 8:66756394-66756416 CAGAGGAGGGTTATGTGGGCTGG + Intronic
1042615523 8:70644577-70644599 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1042701199 8:71616899-71616921 CCAAGGAGACTGAGGTGGGCTGG - Intergenic
1043033874 8:75172183-75172205 CTCAGGAGGATGAGGTGGGAAGG + Intergenic
1043932338 8:86105404-86105426 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1044233027 8:89800869-89800891 TCCTGGGAGGTGAAGTGGGCTGG - Intergenic
1044565667 8:93659100-93659122 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1044649709 8:94481486-94481508 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1044946084 8:97391392-97391414 CCCAGGAGAGTTAAGTGCTCAGG - Intergenic
1045112508 8:98948255-98948277 CCCAGGAGGATGAAGCGCGCCGG + Exonic
1045679874 8:104647072-104647094 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1046325672 8:112641728-112641750 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047396371 8:124502894-124502916 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047467770 8:125135013-125135035 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1047537845 8:125735464-125735486 CCCAGGAAGGCTGAGTGGGCGGG + Intergenic
1048042582 8:130745659-130745681 CCCAGGAGGGTGTGGAGAGCAGG + Intergenic
1049203690 8:141353659-141353681 CAGAGGAGGCTGAAGTGGGAAGG + Intergenic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049568109 8:143353306-143353328 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1049608028 8:143538750-143538772 CCCAGGATGGTGAAGTCAGTGGG - Exonic
1050183860 9:2950439-2950461 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1050702226 9:8353470-8353492 CCCAGGAGGCTGGAGTGTGCTGG + Intronic
1050706211 9:8401270-8401292 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1050994132 9:12191825-12191847 CCCAGGTGGGCCAAGTGGGCGGG + Intergenic
1051553420 9:18355983-18356005 CCCAGGTGGGCCAAGTGGGTGGG - Intergenic
1052937135 9:34102179-34102201 CCCGGGAGGCTGAGGTGGGAGGG + Intronic
1053171600 9:35890853-35890875 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1054150020 9:61594913-61594935 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1054151383 9:61608603-61608625 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1054469784 9:65526015-65526037 CTCAGGAGGCTGAAGCGGGAGGG + Intergenic
1054711349 9:68514223-68514245 CTCAGGAGGCTGAGGTGGGGAGG + Intronic
1054935704 9:70685511-70685533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1055782231 9:79832409-79832431 CTCAGGAGGGTGAGGTGGGAGGG - Intergenic
1055972762 9:81928328-81928350 CCCAGGAAGGTGGAGTCAGCTGG + Intergenic
1055974515 9:81943400-81943422 CCCAGGAAGGTGGAGTCAGCTGG + Intergenic
1055979544 9:81988638-81988660 CCCAGGAGAGTCAGCTGGGCTGG + Intergenic
1056388708 9:86120415-86120437 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1056515727 9:87347452-87347474 CCCAGGAGGTTGAGGTGGGAGGG + Intergenic
1056673969 9:88657267-88657289 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1057084767 9:92199063-92199085 CATAGGAGGCTGAGGTGGGCGGG + Intergenic
1057128112 9:92635046-92635068 CCCAGGAGGATGAAGCATGCCGG - Intronic
1057238189 9:93383221-93383243 TTCAGGAGGCTGAGGTGGGCGGG + Intergenic
1057825819 9:98371316-98371338 CCCAGTAGGGTGAAGGTGGCAGG + Intronic
1057911986 9:99026415-99026437 TACAGGAAGGTGAACTGGGCAGG - Intronic
1058285835 9:103176839-103176861 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1058334047 9:103803497-103803519 CACAGGGGGGTCAAGTGGGCAGG - Intergenic
1058444886 9:105046135-105046157 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1058485929 9:105443513-105443535 CCCAGGAGGGTGATATGGTTTGG - Intergenic
1058626396 9:106938042-106938064 ACTAAGAGTGTGAAGTGGGCAGG - Intronic
1058671883 9:107366977-107366999 CCCAGGTGGTAGGAGTGGGCTGG - Intergenic
1059072341 9:111151982-111152004 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1060297961 9:122355821-122355843 CCCAGGAGGCTGGTGTGGGTTGG + Intergenic
1060313357 9:122484924-122484946 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1060690410 9:125653095-125653117 CTCAGGAGGATGAAATGAGCAGG - Intronic
1060806852 9:126583187-126583209 CCGAGCAGGGTGAGGTGGGGAGG - Intergenic
1060884525 9:127141044-127141066 CCCAGGTGGGTGACGTGGAGAGG + Intronic
1061247439 9:129407916-129407938 CCCAGGAGGTTGAAGTTGCAGGG + Intergenic
1061287481 9:129632334-129632356 CTCCGGAGGGTGAGGTGGGAGGG + Intronic
1061340228 9:129974298-129974320 CACAGGAAGGTGCAGTGAGCTGG - Intronic
1061368549 9:130185407-130185429 CCCAGGAGGTAGGAGAGGGCTGG - Intronic
1061437064 9:130570612-130570634 CTCAGGAGGATGAGGTGGGAGGG + Intergenic
1061445798 9:130636496-130636518 TCGAGGAGGGTGGAGTGGCCAGG + Intronic
1061520580 9:131115151-131115173 CTCAGAAAGGTGAAATGGGCCGG + Intronic
1061527263 9:131176432-131176454 TCCAGGAGGCTGAGGTGGGAAGG - Intronic
1061761383 9:132854376-132854398 ACAAGGAGGGTGGAGAGGGCAGG - Intronic
1061774538 9:132952421-132952443 CCCGGGAGGTTGAGGTGGGAGGG - Intronic
1061917174 9:133761377-133761399 CTCGGGAGGGTGAGGTGGGAGGG - Intergenic
1062005735 9:134237612-134237634 CCCAGGAGGGAGAAAGGGACTGG + Intergenic
1062041956 9:134408366-134408388 CACAGGAGGGTGATTTGGGGAGG - Intronic
1062045435 9:134422531-134422553 CCCAGGAGGGGGGAGTGTCCCGG - Intronic
1062088540 9:134661653-134661675 CTCAGGAAGATGCAGTGGGCTGG - Intronic
1062274396 9:135723932-135723954 CCCCTGAGGGTGCTGTGGGCTGG + Intronic
1203787689 EBV:136890-136912 CCGAGGAGGATGAAGAAGGCGGG + Intergenic
1185863731 X:3604025-3604047 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1186020550 X:5250772-5250794 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1186555573 X:10554808-10554830 CCAAGAAGAGTGAAATGGGCAGG - Intronic
1186752701 X:12638342-12638364 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1186785458 X:12952744-12952766 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
1186802436 X:13106696-13106718 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1187358269 X:18599559-18599581 CTCAGGAGGATGAGGTGGGAGGG - Intronic
1187920049 X:24192785-24192807 CCTAGGAGGCTGAGGTGGGAGGG + Intronic
1188541372 X:31254462-31254484 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1189717794 X:43882997-43883019 GGAAGGAGGGTGAGGTGGGCTGG - Intergenic
1189979930 X:46499268-46499290 CTCAGGAGGTTGAAGTAGGAGGG - Exonic
1190111726 X:47594124-47594146 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1190317756 X:49162783-49162805 CCCTGGAGGCTGAAGCTGGCGGG - Intronic
1190321916 X:49184702-49184724 CTCTGGAGGCTGCAGTGGGCGGG + Exonic
1190440807 X:50472492-50472514 CCAAGGAGGGTGAAGAGAGTGGG - Intergenic
1190693633 X:52933281-52933303 CACAGGGGGCTGAAGTGGGAGGG - Intronic
1190748822 X:53343382-53343404 CTCAGGAGTTTGAAGTGGGAGGG + Intergenic
1190767573 X:53488333-53488355 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1192549324 X:72041572-72041594 CTCAGGAGAGTGGAGGGGGCTGG + Intergenic
1193064062 X:77238845-77238867 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1193122861 X:77841781-77841803 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1194664973 X:96667294-96667316 TTCAGGAGGCTGAGGTGGGCTGG + Intergenic
1195011017 X:100732104-100732126 CCCGGGAGGGTGAGAAGGGCCGG - Intronic
1195031747 X:100933059-100933081 CTCTGGAGGCTGAAGTGGGGAGG + Intergenic
1196055604 X:111351830-111351852 CACAGGAGGCTGAAGTGGGGAGG - Intronic
1196426640 X:115576461-115576483 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1196665431 X:118311047-118311069 CCCAGGAGGCTGAGGTGGGAGGG + Intergenic
1196703417 X:118696071-118696093 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1196722745 X:118870309-118870331 CTCAGGAGGTTGAGGTGGGAGGG - Intergenic
1197213177 X:123845015-123845037 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1197448946 X:126587395-126587417 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1197511155 X:127371062-127371084 CCCAGGAGGGAAAAGTGGTTTGG - Intergenic
1197766119 X:130060433-130060455 CCCTGGAAAGTGAAGGGGGCTGG + Intergenic
1197970764 X:132112663-132112685 CCCAGGATAGTCACGTGGGCCGG - Intronic
1198720234 X:139609716-139609738 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1199221156 X:145316897-145316919 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1199721440 X:150545546-150545568 CCTTGGAGGGTGGAGTGGGAGGG - Intergenic
1200043586 X:153387855-153387877 CCCAGGAGGTTGTGGTAGGCCGG - Intergenic
1200116737 X:153772824-153772846 CCCAGGGGGGTGAAAGGGCCAGG + Intronic
1200157827 X:153986822-153986844 CTCAGGAGGCTGAGGTGGGGAGG + Intergenic
1200766366 Y:7083900-7083922 CCAGGGAGGGTGGAGGGGGCTGG - Intronic
1201705660 Y:16933920-16933942 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1202046179 Y:20738962-20738984 CCATGGAGGGTGGAGGGGGCTGG - Intergenic