ID: 1151961743

View in Genome Browser
Species Human (GRCh38)
Location 17:77409316-77409338
Sequence CCACCACGAAGGAGACACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151961743_1151961753 7 Left 1151961743 17:77409316-77409338 CCGGTGTGTCTCCTTCGTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1151961753 17:77409346-77409368 TGGGGCCAGAGAACAGAGCCTGG 0: 1
1: 0
2: 18
3: 103
4: 615
1151961743_1151961755 21 Left 1151961743 17:77409316-77409338 CCGGTGTGTCTCCTTCGTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1151961755 17:77409360-77409382 AGAGCCTGGCTCCAGAGCCCAGG 0: 1
1: 1
2: 17
3: 125
4: 989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151961743 Original CRISPR CCACCACGAAGGAGACACAC CGG (reversed) Intronic
900397525 1:2459297-2459319 CCACCAGGAAGGAGGACCACTGG - Intronic
900397549 1:2459377-2459399 CCACCAGGAAGGAGGACCACCGG - Intronic
900397568 1:2459441-2459463 CCACCAGGAAGGAGGACCACCGG - Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
901376056 1:8840408-8840430 CCACCAAGATGGAGAAACCCAGG - Intergenic
901879584 1:12185936-12185958 CCACCCTGAAGGAGTCACTCAGG - Intronic
903602153 1:24550354-24550376 CCACCAGGACTGAGACACCCAGG + Intergenic
904418525 1:30377058-30377080 CCACCAGGATGGAGGCAGACAGG + Intergenic
906749676 1:48247750-48247772 CCACCCAGAAGGTGTCACACGGG + Exonic
915688339 1:157660048-157660070 CAACCACAAGGGAGACACAGAGG - Intergenic
922082889 1:222314898-222314920 CCATCACTATGGAGACAGACAGG - Intergenic
924291132 1:242537578-242537600 CCAGCACAAAGGAGACCCAGAGG + Intergenic
1063297194 10:4818379-4818401 CCCCCTCGATGGGGACACACAGG - Intronic
1064396566 10:14986993-14987015 CCAAAACGAAGAAGACACAGAGG + Intronic
1064399361 10:15008387-15008409 CCAAAACGAAGAAGACACAGAGG + Intergenic
1065938498 10:30543048-30543070 CCACCATGAAGGACTCACATAGG - Intergenic
1071156236 10:82692589-82692611 CCACCACACAGGAGACAAAGAGG + Intronic
1075548841 10:123377074-123377096 ATGCCATGAAGGAGACACACGGG - Intergenic
1075559183 10:123456251-123456273 CCCCCACCAAGGTGACACAGGGG - Intergenic
1075638185 10:124044599-124044621 CCGCCATCAAGGAGCCACACTGG - Exonic
1077111818 11:865363-865385 CCACCAAGCTGCAGACACACCGG - Intronic
1077604580 11:3600168-3600190 CCAAAAGGAAGGAGACACAGAGG + Intergenic
1079561890 11:21831769-21831791 CCATCACGAAGTAGACAAAACGG + Intergenic
1081831843 11:46121285-46121307 CCTCCAGGAGGGACACACACAGG + Intergenic
1083751686 11:64764410-64764432 CCACCACCAAAGCCACACACAGG + Intergenic
1084845270 11:71893886-71893908 CCAAAACGAAGAAGACACAGAGG - Intronic
1090407957 11:126488700-126488722 CCACCACCCATGAGCCACACAGG + Intronic
1091409987 12:233058-233080 CCAGCACGTGGAAGACACACTGG - Intronic
1092431733 12:8415304-8415326 CCAAAACGAAGAAGACACAGAGG + Intergenic
1092434684 12:8437924-8437946 CCAAAACGAAGAAGACACAGAGG + Intergenic
1092891716 12:12975250-12975272 CCCCGAGGAAGGAGACACAGAGG + Exonic
1100501477 12:95178359-95178381 CCAGCACTCAGGAGTCACACTGG - Intronic
1101011980 12:100460376-100460398 CCGCCACAAAGGAGACAAAGAGG - Intergenic
1102005557 12:109587247-109587269 TCACCATGATGGAGGCACACAGG + Intronic
1102809356 12:115810686-115810708 CCACTTCCAAGGAGCCACACAGG + Intergenic
1106431479 13:29684590-29684612 CAACCACGAAGGAGACATTTGGG - Intergenic
1107961519 13:45563517-45563539 CCACCAAGAAAGAAACTCACTGG + Intronic
1117039585 14:51757439-51757461 CCAAAACGAAGAAGACACAGAGG - Intergenic
1118481278 14:66168815-66168837 CCACCAGGAATGAGATACACTGG + Intergenic
1122135884 14:99632742-99632764 GCACCACGATGCAGACACAAAGG - Intergenic
1123503290 15:20911933-20911955 CCACCATGAAGGAGAGTCAGTGG - Intergenic
1123560538 15:21485598-21485620 CCACCATGAAGGAGAGTCAGTGG - Intergenic
1123596776 15:21922894-21922916 CCACCATGAAGGAGAGTCAGTGG - Intergenic
1130193139 15:81755262-81755284 ACACCAGGATGGAGACCCACTGG + Intergenic
1202968885 15_KI270727v1_random:212762-212784 CCACCATGAAGGAGAGTCAGTGG - Intergenic
1132565623 16:621252-621274 TCACCAGGCAGGAGAGACACAGG - Intronic
1134553616 16:15149926-15149948 GCACCACGGAGGAGACACCATGG + Intergenic
1135748818 16:25039981-25040003 CGACCACCAAGGAGACTCACAGG - Intergenic
1137606139 16:49788003-49788025 CCGCACAGAAGGAGACACACGGG + Intronic
1138522526 16:57578943-57578965 ACTCCACAAATGAGACACACAGG - Intronic
1140834182 16:78778242-78778264 GCTCCACAAAGGAGACACAGGGG - Intronic
1142067656 16:88072050-88072072 GCACCTGGAGGGAGACACACGGG - Exonic
1142269215 16:89080410-89080432 CCACAAGGAAAGAGACGCACAGG - Intergenic
1144028057 17:11296077-11296099 CCACTACGCAGGAGTCACACTGG - Intronic
1149382217 17:56105638-56105660 ACCCCAAGAAGGAGACAGACAGG - Intergenic
1151961743 17:77409316-77409338 CCACCACGAAGGAGACACACCGG - Intronic
1152797436 17:82315163-82315185 CCAGCTCCAAGCAGACACACAGG - Exonic
1154240148 18:12645925-12645947 CCACTACAAAGAAGACAAACAGG + Intronic
1160536767 18:79598596-79598618 CCACCACCAAGGAGGCAGAACGG + Intergenic
1162503428 19:11067860-11067882 CCAGCAAGATGGACACACACTGG + Intergenic
1162638446 19:11988223-11988245 CAATCATGAAGGAGAAACACCGG + Intergenic
1163599026 19:18237006-18237028 CCACCACCAAGGGGGCTCACAGG + Exonic
1165167830 19:33869639-33869661 ACACCACGGAGCAGAAACACAGG + Intergenic
925046009 2:773664-773686 CCCCCACCCAGCAGACACACTGG + Intergenic
925046133 2:774086-774108 CCCCCACCCAGCAGACACACTGG + Intergenic
925047791 2:787798-787820 CCACCAGGAATGAGAACCACTGG + Intergenic
926058264 2:9789408-9789430 CCAGCTGGAAGGACACACACTGG + Intergenic
926577216 2:14595502-14595524 TCACCTGGAAGGAGCCACACAGG + Intergenic
927530044 2:23788511-23788533 CCACCACGAAGGAAACATGCTGG - Exonic
928375440 2:30769789-30769811 CCACCTCGTAGCAGCCACACCGG + Intronic
932593017 2:73078492-73078514 CCACCACCAGGGAGGGACACTGG + Intronic
934697062 2:96407590-96407612 CAAGCACGAAGCAGCCACACTGG + Intergenic
935828381 2:106974170-106974192 CCCCCAGGAAGCAGACACAGAGG + Intergenic
938212817 2:129482889-129482911 CCAGGCCGACGGAGACACACTGG + Intergenic
940870262 2:158854027-158854049 CCAAAACGAAGAAGACACAGAGG - Intronic
940872974 2:158875124-158875146 CCAAAACGAAGAAGACACAGAGG - Intergenic
1174498210 20:50964801-50964823 CAACCACGAACAAGACAGACTGG + Intergenic
1174914590 20:54641735-54641757 GTACCACGAAGGAGACACAGGGG - Intronic
1175457996 20:59129676-59129698 CGACCATGAAGGGGCCACACAGG - Intergenic
1178073056 21:28990632-28990654 CCACCAATAAGGGGACAAACAGG + Intronic
1179076390 21:38126309-38126331 CAGCCACGGAGGAGACACAGGGG + Intronic
1180037423 21:45256903-45256925 CCACCAAGTAGGAGAAACCCCGG + Intergenic
1180621347 22:17164602-17164624 CCACCAGGAAAGAGACAAAAAGG + Intronic
1181139347 22:20792693-20792715 CCAACACGATGGTGCCACACAGG + Intronic
1184230421 22:43155660-43155682 CCCCCAAGAAGCAGACACAGCGG + Intronic
1184675393 22:46039201-46039223 GCTCCAGGAAGGAAACACACAGG + Intergenic
1185151119 22:49164483-49164505 CCACCACACAGGAGACAGACAGG - Intergenic
949577058 3:5348699-5348721 CCACCAAGAATGACTCACACTGG + Intergenic
954871375 3:53769815-53769837 CCACCTCCAAGGAGAGCCACTGG + Intronic
957075430 3:75599175-75599197 CCAAGACGAAGAAGACACAGAGG + Intergenic
961273013 3:125703791-125703813 CCAAAACGAAGAAGACACAGAGG - Intergenic
961875726 3:130022080-130022102 CCAAAACGAAGAAGACACAGAGG + Intergenic
962343531 3:134604038-134604060 CCATCACTGAGGAGACACAGCGG - Exonic
966891389 3:184409875-184409897 ACACCACAAAGGAGAGAAACAGG - Intronic
968988082 4:3889827-3889849 CCAAAACGAAGAAGACACAGAGG + Intergenic
969023714 4:4157003-4157025 CCAAAACGAAGAAGACACAGAGG + Intergenic
969786269 4:9459698-9459720 CCAAAACGAAGAAGACACAGAGG - Intergenic
969794187 4:9513348-9513370 CCAAAACGAAGAAGACACAGAGG - Intergenic
978622866 4:110651736-110651758 CCTCCACCAAAGAGTCACACCGG + Intergenic
985136127 4:186787846-186787868 CCATCACTAAGGAGACAGGCAGG + Intergenic
985533259 5:446201-446223 TCACCATGAAGGAGACAGACCGG + Exonic
989578538 5:43010827-43010849 CCCACACGGAGGAGACACATTGG + Intergenic
992386017 5:76285232-76285254 CCACCACGGAGGAGACACAGGGG - Exonic
999233002 5:150073300-150073322 CTACCACCAAGGACACATACAGG - Exonic
999335906 5:150716301-150716323 ACAACACAAAGGAGAAACACTGG + Intronic
999398217 5:151244348-151244370 CCACCAAGAAGCAGAGCCACAGG + Intronic
1001629040 5:173160899-173160921 CCATCACAGAGGAGACACTCTGG - Intronic
1003491978 6:6630715-6630737 CGACCAAGATGGAGACCCACTGG - Intronic
1005732362 6:28710340-28710362 CCACCACCAAGGAGAATCCCAGG - Intergenic
1006507913 6:34502343-34502365 CCACAATGAAGGAGAAACAGAGG + Intronic
1007632867 6:43282633-43282655 CCACAACCTAGGAGACTCACAGG - Intronic
1008421561 6:51306373-51306395 CCACCCCGTAGCACACACACAGG - Intergenic
1012937264 6:105380998-105381020 TCACCCTGAAGCAGACACACTGG + Intronic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1019768880 7:2870971-2870993 CCACCCCGACGGTGACACAAAGG + Intergenic
1026786226 7:73303384-73303406 CCACCAGGAAGGAGTCAGCCCGG + Exonic
1026955185 7:74372456-74372478 CCTCCACACAGGAGACCCACAGG - Intronic
1027107853 7:75416609-75416631 CCACCAGGAAGGAGTCAGCCTGG - Intergenic
1029077527 7:97947507-97947529 CCAAAACGAAGAAGACACAGAGG + Intergenic
1029672061 7:102040187-102040209 GCACTGCGAGGGAGACACACTGG + Intronic
1030074728 7:105726517-105726539 CCAGCACTAAGGAGACAGAGGGG - Intronic
1034172269 7:149071694-149071716 CCACCAGGAAGGGGACACGGAGG - Exonic
1036261790 8:7247142-7247164 CCAAAACGAAGAAGACACAGAGG + Intergenic
1036304801 8:7592410-7592432 CCAAAACGAAGAAGACACAGAGG - Intergenic
1036313830 8:7705687-7705709 CCAAAACGAAGAAGACACAGAGG + Intergenic
1036355652 8:8040402-8040424 CCAAAACGAAGAAGACACAGAGG - Intergenic
1036819518 8:11929092-11929114 CCAAAACGAAGAAGACACAGAGG + Intergenic
1036902862 8:12684664-12684686 CCAAAACGAAGAAGACACAGAGG + Intergenic
1038149382 8:24928577-24928599 ACAGCTCGGAGGAGACACACAGG - Intergenic
1039163942 8:34655088-34655110 CCACCAAGAAGGACAGCCACGGG + Intergenic
1043717600 8:83506502-83506524 CCAACATGAAGGAGAAAAACTGG + Intergenic
1044719267 8:95130093-95130115 CCTCCACACAGGAGCCACACAGG - Intergenic
1044797049 8:95912360-95912382 CCACCATGAAGAAGACACAATGG - Intergenic
1048597532 8:135882146-135882168 CCACCAGGAGGGGGACACAGTGG - Intergenic
1054843917 9:69772343-69772365 CCACTGAGAAGGAGACACAAGGG - Intergenic
1056993429 9:91431867-91431889 GATCCAGGAAGGAGACACACTGG - Intergenic
1203774559 EBV:65507-65529 CCACCACAAAGGTGGCACACTGG - Intergenic
1186355710 X:8787751-8787773 CTACCCCCAAGGAGAAACACTGG - Intergenic
1193573716 X:83175275-83175297 CCACCAAGAAAGAGGCACAATGG - Intergenic
1195399065 X:104442480-104442502 CCACCACAATGGAGAGACATTGG - Intergenic
1195883385 X:109615840-109615862 CCAGCAGGAGGGAGACACAAAGG + Intergenic
1197307855 X:124865025-124865047 CAAGCACGAAGGAGAAACAAAGG + Intronic
1199039468 X:143094575-143094597 CCACCATAATGAAGACACACAGG + Intergenic
1200373114 X:155748737-155748759 CCACCATGAAGGGGAAATACTGG + Intergenic