ID: 1151973777

View in Genome Browser
Species Human (GRCh38)
Location 17:77472474-77472496
Sequence GCTCCTTTGCAGGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151973777_1151973782 -5 Left 1151973777 17:77472474-77472496 CCTTCCAGGTCCTGCAAAGGAGC 0: 1
1: 0
2: 3
3: 33
4: 215
Right 1151973782 17:77472492-77472514 GGAGCACACAGGGTTCTTGTTGG 0: 1
1: 0
2: 1
3: 15
4: 171
1151973777_1151973784 24 Left 1151973777 17:77472474-77472496 CCTTCCAGGTCCTGCAAAGGAGC 0: 1
1: 0
2: 3
3: 33
4: 215
Right 1151973784 17:77472521-77472543 CACCTTGTTAGTCACCAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151973777 Original CRISPR GCTCCTTTGCAGGACCTGGA AGG (reversed) Intronic
901004143 1:6163595-6163617 GCCCATGAGCAGGACCTGGAGGG + Intronic
901502119 1:9658963-9658985 GCTCCTTTGCAGACACTGCATGG - Intronic
903073444 1:20741889-20741911 GCTCCTTTGGAATGCCTGGAAGG + Intergenic
903131094 1:21280014-21280036 CCTCCCTTTCAGGACCTGAATGG - Intronic
903608075 1:24589567-24589589 GCTCCTCTACAGGTCCTGCAGGG - Intronic
905093891 1:35452296-35452318 GCCCCTGTCCAGGAGCTGGAGGG - Intronic
906202680 1:43970245-43970267 ACTCCTCTTCCGGACCTGGACGG + Exonic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907799585 1:57751413-57751435 GCTCCTGAGCAGCAACTGGAGGG + Intronic
908124549 1:61017168-61017190 GCTCCTTTGCTGGCCCTTAATGG - Intronic
911341244 1:96641333-96641355 GCTCCTTTACATGCTCTGGAAGG - Intergenic
911706640 1:101021532-101021554 GTTCCTTATCAGGACCTGGCAGG + Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
912467031 1:109881416-109881438 ACTCCTCAGCACGACCTGGATGG - Intergenic
912738725 1:112173981-112174003 ACTCCTTTCCTGGACCTGCAGGG - Intergenic
912929122 1:113940608-113940630 GCTCCACTGCAGGAGCTGGGAGG - Exonic
913107216 1:115625530-115625552 GCTTCTCTGCAGGCCCTGGCAGG - Intergenic
914885345 1:151580016-151580038 GCTCCTTTGCAAAGCCTGGAGGG - Intronic
916040090 1:160954319-160954341 TCTGCTGTGCAGGGCCTGGAGGG - Intronic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
917222140 1:172743228-172743250 GATCCTCTGAAGGGCCTGGATGG + Intergenic
917973499 1:180223876-180223898 GCTCCATGACAGGCCCTGGAAGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
1063454274 10:6172266-6172288 GCTCCTTTGCAGGAAGGAGAGGG + Intronic
1065917671 10:30366413-30366435 GCCCCTTAGGAGCACCTGGAAGG - Intronic
1070434222 10:76372760-76372782 TCTCCTTTGCAGGTCCTGCTGGG + Intronic
1070765056 10:79051661-79051683 GTTCCTTTGCACGCGCTGGAAGG - Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1073057791 10:100713428-100713450 GCTCCATTCCAGGAGCTGGTGGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075442874 10:122493769-122493791 ACTCCTTACCAGGACCTTGAGGG + Intronic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078941470 11:16011250-16011272 GCTCCTATGTAGGACATGTAAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1082002128 11:47398975-47398997 GCTCCTTCTGAGGCCCTGGAAGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086530457 11:87778686-87778708 GCCCCTTTGCAGCACATGAAAGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1090838608 11:130471396-130471418 GCTCCCTGGCAGGACCTTCAGGG - Intronic
1092083088 12:5734456-5734478 GCCCCTGTGCAGGGTCTGGAAGG - Intronic
1095072022 12:37864399-37864421 GCTCCTTTGTAGAATCTGCAAGG - Intergenic
1095885471 12:47184402-47184424 GCTACTTGGCATCACCTGGATGG - Intronic
1102541475 12:113622477-113622499 TCTCCTTTGCAAGAGCTGAAGGG - Intergenic
1103043106 12:117712052-117712074 GCCCCTTTTCTGGACCTGGGAGG - Intronic
1104318106 12:127723034-127723056 GCCACCTTCCAGGACCTGGAAGG + Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105853629 13:24357914-24357936 GTTCCTGTTCAGGGCCTGGAAGG - Intergenic
1109278323 13:60326445-60326467 ACTCCTTTGCAGGGCCTATAAGG - Intergenic
1111860373 13:93697113-93697135 GCTCCTTAGCATGACCTGCAAGG + Intronic
1114568192 14:23647595-23647617 GCTCCTTTCCAGGAACTCCATGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115790510 14:36872667-36872689 TCTCCTTCGGAGCACCTGGAAGG + Intronic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1119112637 14:71989306-71989328 GCTCTTTCACAAGACCTGGAAGG + Intronic
1121721414 14:96111503-96111525 GCTCCATGGCAGGTCCTTGATGG - Intergenic
1121883729 14:97523787-97523809 GCTCATTTTCAGGTACTGGATGG - Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1122787662 14:104171395-104171417 GCTGCTCTGCAGGACCTGAGCGG + Intronic
1124847893 15:33309922-33309944 GCTCCCTTCCAGGTCCTGGAAGG - Intergenic
1124905874 15:33867989-33868011 GCTCCTTTCCAGGCCCTGGTGGG + Intronic
1129257847 15:74344191-74344213 GCCCCTCTGCAGGACCTGTGTGG - Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1132501453 16:286277-286299 GGTCCTGTGCAGGGCCTGGGGGG - Intronic
1132701701 16:1224875-1224897 TTTCCTGAGCAGGACCTGGAGGG - Intronic
1133630289 16:7614015-7614037 GCTGCTTTGAAGGGCTTGGATGG - Intronic
1137340010 16:47592325-47592347 GCTACTTAGCATGACCTGCAAGG + Intronic
1137698517 16:50478792-50478814 GCACCCTTGGGGGACCTGGAAGG - Intergenic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1141557861 16:84847751-84847773 GCTCCTTTGCAGCACCTGGCTGG + Intronic
1141977317 16:87525545-87525567 GCTCATTTGCAGGTTCTGCAAGG + Intergenic
1142179313 16:88659632-88659654 CCTCCCTAGCAGGACCAGGAAGG + Intronic
1142667830 17:1472594-1472616 GCTGCTCTGCGGGACCTGGAAGG + Intronic
1142968660 17:3596671-3596693 GCTCCTTGGAAGCACCTGGGAGG - Intronic
1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG + Intronic
1143365974 17:6408810-6408832 GCTCCTTTTCAGGACCCGTTTGG - Intronic
1144021975 17:11245699-11245721 GCTCCTGTGCAGGCAGTGGAAGG - Intronic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1146618288 17:34374254-34374276 GCTCCTTTGCAGGCCTTTGGAGG - Intergenic
1147363219 17:39944267-39944289 GCGGCTTTCCAGGGCCTGGAGGG + Exonic
1147559355 17:41499473-41499495 CCTCCTCTGCAGCACCTGGCTGG - Intergenic
1147995713 17:44359431-44359453 GCTCATTTGTAAGACGTGGAAGG - Intronic
1151559580 17:74863080-74863102 GCTGCTGAGCAGGGCCTGGATGG + Exonic
1151666813 17:75549852-75549874 ACTCCTTTCCAGGTCCCGGAAGG - Intronic
1151829871 17:76543185-76543207 GCTCCTGAGCAGGACCTGGCTGG + Exonic
1151947040 17:77325480-77325502 GCTCCTGCCCAGGACCTGGCTGG + Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152252290 17:79218448-79218470 GCTCCTTTGCTGGACCTTCCAGG - Intronic
1152678595 17:81654164-81654186 GCTCCTCTGCTGGGCCTGGCAGG - Intronic
1152809052 17:82372445-82372467 GCACATTTCCAGGCCCTGGAAGG + Intergenic
1152941838 17:83176945-83176967 GCTCCTGTGCGGGACATTGATGG - Intergenic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153872246 18:9332091-9332113 CCTCTTTGACAGGACCTGGAAGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1155877193 18:31101934-31101956 GCTCCGTTCCAGGAGCCGGAGGG + Exonic
1156019704 18:32585985-32586007 GCCTATTTGCAGGAACTGGAGGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160364381 18:78311978-78312000 GCACCTTTCCATGCCCTGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1163023763 19:14497474-14497496 GCCCCTCTGCAGGTCCTGGTGGG - Intergenic
1163102726 19:15107753-15107775 GCTCCTTGGGAGGCCCGGGAGGG + Intronic
1164042589 19:21506546-21506568 GGTCCTTTGGAGGAGCTTGAAGG + Intronic
1164564918 19:29318820-29318842 CCACCTTTGCAAGCCCTGGAAGG + Intergenic
1164569617 19:29363395-29363417 GCAACATTGCAGGACCTGGAGGG + Intergenic
1166417599 19:42607329-42607351 GCCTCTTTTCAGGCCCTGGAGGG - Intronic
1167810841 19:51828879-51828901 GCTCCCCTGCAGCTCCTGGAGGG + Intergenic
927029641 2:19107137-19107159 GCTCCCTGGCTGGAGCTGGATGG + Intergenic
928221439 2:29406545-29406567 GTTCCTTTGCAGAGCCTGCATGG + Intronic
930109164 2:47664015-47664037 GCCCCGAGGCAGGACCTGGAAGG + Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936093016 2:109512834-109512856 GCTCCCTTGCTGGCCCAGGAGGG - Intergenic
937164482 2:119798911-119798933 GCTGATTTTCAGGACCTGAAGGG + Intronic
937342475 2:121100016-121100038 GCTCATTTGCATGCCCTGGTTGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
938079917 2:128364499-128364521 GCTCCCTGGCCGGGCCTGGAAGG - Intergenic
939055381 2:137359216-137359238 GCTCCTTTCCAGGACCCTGAAGG - Intronic
939476352 2:142693222-142693244 GTTCCTTTGAAGGAACTGGCAGG + Intergenic
939861613 2:147427724-147427746 GCTACTTTGGAGGCCCAGGAAGG - Intergenic
940040073 2:149350940-149350962 GCTTATTTCCAGGAACTGGACGG + Intronic
944850940 2:203718272-203718294 GCTCCTTTTCAGGCTCTGTAAGG - Intronic
946017142 2:216613030-216613052 GATCCTATGCAAGACCTTGAAGG + Intergenic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
948194110 2:236082417-236082439 GCCCCGTAGCAGGACCTGGTGGG - Intronic
949073650 2:242041383-242041405 GCTCCTCTGCAGCACATGGCAGG - Intergenic
1168918660 20:1512753-1512775 GCTCCAGAGCAAGACCTGGAAGG + Intergenic
1170086203 20:12535254-12535276 GACCCTTTGAAGGATCTGGATGG + Intergenic
1170695302 20:18652437-18652459 GCTCCTATTCAGGAGCTGGCAGG + Intronic
1170743213 20:19075762-19075784 TCTCCTTTGCAATGCCTGGAAGG + Intergenic
1173159528 20:40642029-40642051 GCAGATTTGCAGGGCCTGGAAGG - Intergenic
1174533972 20:51236837-51236859 GCTCCTTACCAGGGCCTGCAAGG - Intergenic
1175228031 20:57456321-57456343 GGGCCTTTGCACGGCCTGGAAGG + Intergenic
1175521124 20:59603636-59603658 CCCCCTTTGCAGGTGCTGGAAGG - Intronic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1178141462 21:29688808-29688830 GATCCTTTGCACGACCTTCACGG - Intronic
1178511809 21:33211678-33211700 GCTGCTTCGCCGGCCCTGGAGGG - Intergenic
1179326972 21:40356594-40356616 GCTTCTTTACATCACCTGGAAGG + Intronic
1179567908 21:42260648-42260670 GCTCCTTGGCAGGAGCTGCTTGG - Intronic
1180593227 22:16957870-16957892 GCTCCTCTCCAGCTCCTGGATGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181864720 22:25846180-25846202 GCTCCTCTGCAGGGCCTGCTGGG - Exonic
1183472386 22:38016537-38016559 GCTGCTTGGCAGGACTTGGTGGG + Intronic
1184771077 22:46596922-46596944 ACTCCTTTGCAGAGCTTGGATGG + Intronic
1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952797303 3:37252219-37252241 GTTCCTTTGCTTGACCTGGGAGG - Intronic
952992577 3:38844571-38844593 GCTCCTGTGCAGGACTGGGAGGG - Intergenic
954938109 3:54345509-54345531 GCTCTTTTCCATGACCTGCAAGG + Intronic
955713811 3:61807834-61807856 GCTGCTTTGCAGGAACAAGAGGG - Intronic
956699612 3:71947552-71947574 GCTCCTTTTCAGGTGCTGCATGG - Intergenic
957437630 3:80199553-80199575 GCTCTCTTGCAGCACCTGGATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960967568 3:123115817-123115839 GCTCATTTGCAGGCCCTGCCTGG + Intronic
961536126 3:127572141-127572163 GCTCCCTGGGAGGGCCTGGAGGG - Intergenic
962388512 3:134952619-134952641 GCTCATTGCCAGGCCCTGGAAGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964395022 3:156236259-156236281 GCAACTTTGCAGGAGCTGAACGG - Intronic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969493267 4:7511930-7511952 CTCCCTTTGCAGGTCCTGGAGGG + Intronic
969724593 4:8911708-8911730 GCTCCTGTGGAGGCCCTGCAGGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
973656288 4:53051387-53051409 GCTCCGTTGCTGGTCCTGGAAGG - Intronic
973884151 4:55303816-55303838 GCACCCTGGCAGGACTTGGAGGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
976762948 4:88569713-88569735 GCTGATATGCATGACCTGGAGGG - Intronic
978069946 4:104454692-104454714 GATACTTTGCAGGCCCTTGATGG - Intergenic
981023240 4:140050539-140050561 GCTGCTTTGGAGAACCTGGGAGG - Intronic
986284700 5:6350766-6350788 GCTCCTCTGCAGGACCTGAATGG + Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
997372218 5:133369373-133369395 TCTCCTCAGCAGGACCTGGGTGG + Intronic
997787819 5:136729513-136729535 GCTCCTTTTCTGGACCAGGATGG + Intergenic
998004238 5:138646778-138646800 CCTCCTCTGCTGGACCTGGCGGG + Intronic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998663366 5:144266309-144266331 GCTCCTTTCCACAACCTGTATGG + Intronic
999776613 5:154817070-154817092 GCTGCTTAGAAGGCCCTGGAAGG + Exonic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001024673 5:168214076-168214098 GCTTTTTTGCAGGGGCTGGAGGG - Intronic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002473551 5:179451632-179451654 GCTCCCTTCCAGGATCAGGAAGG - Intergenic
1002480551 5:179498109-179498131 GCTCCCTTCCAGGATCGGGAAGG + Intergenic
1003385768 6:5666023-5666045 GCTCCATGGCAGGATCTGGAGGG + Intronic
1003530144 6:6930284-6930306 GCTCACTTGAAGCACCTGGATGG - Intergenic
1004540769 6:16547621-16547643 TCTCCTTTGCACCTCCTGGAAGG - Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1010934891 6:81849529-81849551 GCTCCCTTCCAGGACCATGAAGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1018244096 6:161805397-161805419 GCTCCCTAGCGGGACCTCGATGG - Intronic
1019309470 7:353176-353198 ACCCTTTTGCAGGGCCTGGAGGG + Intergenic
1019607292 7:1916611-1916633 ACTCCCTTGCAGGGCCTGGAGGG - Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1025909120 7:65813243-65813265 GCTCTTTTGTAGGACAGGGATGG - Intergenic
1026892694 7:73991843-73991865 GCTCCTTTGTGGGCTCTGGAAGG - Intergenic
1026909510 7:74084002-74084024 GCTACTTTGTTGCACCTGGAGGG + Exonic
1027204731 7:76088803-76088825 GCTCTTTTTTAGGACCGGGATGG + Intergenic
1028561271 7:92179031-92179053 GCTCCTTCGCAGGACCGGTAGGG + Exonic
1029046357 7:97633184-97633206 GCTCCTTTGCAGGAAAAAGAAGG + Intergenic
1029725974 7:102404764-102404786 GTTCCTCTGCATGACCTGTAGGG + Intronic
1032364289 7:131284955-131284977 GCTTCCTGGCAGGGCCTGGAAGG + Intronic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1034302718 7:150030714-150030736 GCTCCTGAGCAGGACCTTCAAGG - Intergenic
1034803341 7:154066584-154066606 GCTCCTGAGCAGGACCTTCAAGG + Intronic
1035635414 8:1140282-1140304 GCTCCTTGGGAGGCTCTGGATGG + Intergenic
1036615986 8:10388025-10388047 GCTCCATTGGAGAACCTAGAAGG - Intronic
1039329395 8:36520435-36520457 GCTCGTGTGCAGGCTCTGGAGGG - Intergenic
1039931232 8:41991511-41991533 GTTCTCTTTCAGGACCTGGATGG + Intronic
1040532303 8:48275790-48275812 TCTCCTTTGCAAGAACTGGTTGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048283760 8:133125136-133125158 TCTCATTTCTAGGACCTGGAAGG - Intronic
1048462841 8:134636951-134636973 GCTCCTATGAGGGACCTCGATGG - Intronic
1048969977 8:139640011-139640033 GCTGCTTGGCAGGAAGTGGATGG - Intronic
1048992659 8:139770377-139770399 GCTCCTTTGCAGAGCGGGGAAGG + Intronic
1049081803 8:140449045-140449067 GGTGCTTTGCAGGGTCTGGAAGG - Intronic
1049400333 8:142423863-142423885 GTGCCTTTCCAGGACCTGGCAGG - Intergenic
1049494099 8:142921676-142921698 GCTCCTTAGCAGGACCAGTGAGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1056654330 9:88496773-88496795 GGCCCTGTGCAGGACCTTGATGG - Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058995180 9:110292381-110292403 CCTCCTTTGCAGGACGAGGTGGG - Intergenic
1187285479 X:17899599-17899621 GCAACTGTGCAGGGCCTGGAGGG + Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1190278423 X:48913924-48913946 GCTCCTTTGTAGGATTGGGAAGG + Exonic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191252979 X:58268169-58268191 GCCCCTTTGCCGGGCCTGGCGGG - Intergenic
1193385917 X:80871574-80871596 GCTCTTTTTCAGGACCATGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194408383 X:93526753-93526775 ACTCTTTTACAGGATCTGGAGGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201865795 Y:18652801-18652823 GGTACTTTGAAGGAGCTGGAAGG - Intergenic