ID: 1151974074

View in Genome Browser
Species Human (GRCh38)
Location 17:77474613-77474635
Sequence AGTATGGGGTTCCTGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151974074_1151974089 21 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974089 17:77474657-77474679 CCGAAGACCTGGCCTGGGGAGGG 0: 1
1: 0
2: 4
3: 31
4: 240
1151974074_1151974083 15 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974083 17:77474651-77474673 TGGTTCCCGAAGACCTGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 119
1151974074_1151974084 16 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974084 17:77474652-77474674 GGTTCCCGAAGACCTGGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 118
1151974074_1151974081 10 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974081 17:77474646-77474668 TTCCATGGTTCCCGAAGACCTGG 0: 1
1: 0
2: 2
3: 12
4: 78
1151974074_1151974078 -5 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974078 17:77474631-77474653 ATACTTCTCCAGCCTTTCCATGG 0: 1
1: 0
2: 0
3: 22
4: 198
1151974074_1151974091 23 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974091 17:77474659-77474681 GAAGACCTGGCCTGGGGAGGGGG 0: 1
1: 0
2: 6
3: 91
4: 813
1151974074_1151974085 17 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974085 17:77474653-77474675 GTTCCCGAAGACCTGGCCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 231
1151974074_1151974087 20 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974087 17:77474656-77474678 CCCGAAGACCTGGCCTGGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 218
1151974074_1151974090 22 Left 1151974074 17:77474613-77474635 CCTGGCTGCAGGAACCCCATACT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1151974090 17:77474658-77474680 CGAAGACCTGGCCTGGGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151974074 Original CRISPR AGTATGGGGTTCCTGCAGCC AGG (reversed) Intronic