ID: 1151977063

View in Genome Browser
Species Human (GRCh38)
Location 17:77489073-77489095
Sequence CCCAAGACGCAGCTGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151977063_1151977077 22 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977077 17:77489118-77489140 TGGGCTGTTCTGGAGCCTGGTGG 0: 1
1: 0
2: 4
3: 42
4: 343
1151977063_1151977071 2 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977071 17:77489098-77489120 GCTGAGGGTCAGGCAGGCCCTGG 0: 1
1: 3
2: 9
3: 79
4: 686
1151977063_1151977070 -4 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977070 17:77489092-77489114 TGGGGAGCTGAGGGTCAGGCAGG 0: 1
1: 0
2: 7
3: 71
4: 718
1151977063_1151977073 12 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977073 17:77489108-77489130 AGGCAGGCCCTGGGCTGTTCTGG 0: 1
1: 0
2: 2
3: 46
4: 367
1151977063_1151977069 -8 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977069 17:77489088-77489110 GTCTTGGGGAGCTGAGGGTCAGG 0: 1
1: 0
2: 1
3: 34
4: 335
1151977063_1151977072 3 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977072 17:77489099-77489121 CTGAGGGTCAGGCAGGCCCTGGG 0: 1
1: 2
2: 3
3: 55
4: 427
1151977063_1151977075 19 Left 1151977063 17:77489073-77489095 CCATCCTTCAGCTGCGTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1151977075 17:77489115-77489137 CCCTGGGCTGTTCTGGAGCCTGG 0: 1
1: 0
2: 2
3: 53
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151977063 Original CRISPR CCCAAGACGCAGCTGAAGGA TGG (reversed) Intronic
900087184 1:904281-904303 CCCAGGACGCAGCAGAGGGTGGG + Intergenic
900619857 1:3581734-3581756 CCCCAGGCTCTGCTGAAGGACGG + Intronic
900999936 1:6143878-6143900 CCCAAGAGGCTGCTCAAGAAGGG - Exonic
906530485 1:46520957-46520979 CCCATGAGGCTGCTGCAGGAGGG - Intergenic
906961066 1:50419683-50419705 CCTAAGACGCTGCTGCAGGCAGG - Exonic
907908682 1:58808423-58808445 CCAAAGAGGCAGGGGAAGGAGGG + Intergenic
910108487 1:83656841-83656863 CCCATGTCCCAGATGAAGGATGG + Intergenic
914727262 1:150338247-150338269 CCTAAGAAGGAGCTAAAGGAAGG + Exonic
915596409 1:156898894-156898916 ACCAAGAAGCTGATGAAGGAAGG + Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
922817973 1:228464515-228464537 ACCAAGGCGCAGAAGAAGGACGG - Intergenic
924325756 1:242892556-242892578 CCCAGGAAGCTCCTGAAGGAGGG + Intergenic
1064874989 10:19983852-19983874 CCCAGGACTCACCTGAGGGAAGG - Intronic
1070907292 10:80084350-80084372 CCACAGACCCACCTGAAGGACGG - Intronic
1071332183 10:84571336-84571358 CCCAGGCCGCAGCTGCCGGAGGG + Intergenic
1072608687 10:97002857-97002879 ACCAAGACGCAGATGAAGCCAGG - Exonic
1073205514 10:101767367-101767389 CCCATGACGCCCCAGAAGGACGG - Intergenic
1074499228 10:114007791-114007813 CCCTAGAGGCAGGTCAAGGAAGG - Intergenic
1078456331 11:11478534-11478556 GCCCAGATGCAGCAGAAGGATGG + Intronic
1079402675 11:20118391-20118413 CCCAGGTCGAGGCTGAAGGACGG - Exonic
1082808214 11:57463182-57463204 CCCAATTTGCAGATGAAGGAAGG - Intronic
1088503309 11:110506054-110506076 CCCCAGGTCCAGCTGAAGGAAGG + Intergenic
1089295560 11:117465157-117465179 CCCAAGAAGGAGCTGCAGAACGG - Exonic
1089646094 11:119880126-119880148 CCCGAGACGCAGCTGTAGATGGG - Intergenic
1090225805 11:125071643-125071665 CCCACGTCCCAGCTGGAGGAAGG + Intronic
1091792593 12:3280394-3280416 GCCAAGAAGGACCTGAAGGAAGG + Exonic
1093337286 12:17921391-17921413 GCCAACACCCAGCTGTAGGAGGG + Intergenic
1094310125 12:29071117-29071139 CCCAAGAAGCAGCTGTTGAAAGG - Intergenic
1102536113 12:113582806-113582828 CCCAGGTCACAGCTGAGGGAGGG - Intergenic
1102711962 12:114936052-114936074 CTCAAGAGGCAACTCAAGGAAGG + Intergenic
1104532859 12:129588930-129588952 CACAAGGCACGGCTGAAGGAAGG - Intronic
1105870074 13:24496726-24496748 CCCAAGACAGAGCTGTAGGCAGG + Intronic
1114206996 14:20581420-20581442 CCCAAGATGGTACTGAAGGAAGG - Intergenic
1115791773 14:36887630-36887652 CCAGAAAGGCAGCTGAAGGAGGG + Intronic
1121573003 14:94961736-94961758 CCCAGGCCACAGCTGATGGAAGG - Intergenic
1122579832 14:102764599-102764621 CCCAGGAAGCTGCTGGAGGAGGG - Intergenic
1124258988 15:28170066-28170088 CCCAGGTCTCAGCAGAAGGAGGG + Intronic
1124911803 15:33928567-33928589 TCCAAGACGCAACTGAATGGGGG + Intronic
1125516779 15:40324863-40324885 CCCAAGACTCAGGGGAAGGATGG + Intergenic
1127787237 15:62366273-62366295 CCCAAGACACAGCAGATGAAGGG + Intergenic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1129873216 15:78955011-78955033 CCCATGACCCAGCTGAAGAGTGG - Intergenic
1130980268 15:88807533-88807555 CCCTGGACGCAGTTGAAGAAGGG + Intronic
1131047345 15:89324526-89324548 CCCAAGGCCCAGCTGCAGGCTGG + Intronic
1131294707 15:91136778-91136800 GCCAAGAGGCATCTGAAGGCTGG + Intronic
1131708592 15:95026321-95026343 CCCAAGAAGCAGCCACAGGAGGG + Intergenic
1132077246 15:98832066-98832088 CCCAAGAAGCAGAGGAATGAAGG - Intronic
1135087537 16:19487280-19487302 CACAAGACCCCGGTGAAGGATGG - Exonic
1138350583 16:56344373-56344395 CCCCAGGCAAAGCTGAAGGATGG - Exonic
1139798337 16:69500665-69500687 CCCAAGACACAGCAGCAGCATGG + Intergenic
1141139743 16:81489625-81489647 CCCAGGACCCAGCTGTGGGATGG + Intronic
1141592967 16:85080934-85080956 CCCAAGACGAAGCAGAGGGCTGG - Intronic
1142427993 16:90010981-90011003 TCCAGGAAGCAGCTGAGGGAAGG - Intronic
1147503806 17:40993794-40993816 CCCAAGAGGCTGCTAATGGATGG - Exonic
1147504240 17:40999550-40999572 CCCAAGAGGCTGCTGATGGATGG - Exonic
1151713452 17:75819533-75819555 CATAGGAAGCAGCTGAAGGAAGG + Intronic
1151765276 17:76130575-76130597 CGCAGGACGCAGCTGGAGGCCGG - Intergenic
1151977063 17:77489073-77489095 CCCAAGACGCAGCTGAAGGATGG - Intronic
1152292398 17:79447565-79447587 CCCAAGATGCAGCACAGGGAGGG + Intronic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1153987859 18:10368942-10368964 GCCTAGACACAGCTGGAGGAGGG - Intergenic
1156370347 18:36467182-36467204 CCTAAGACGAAGGTGAAGGGTGG - Intronic
1157499053 18:48177393-48177415 TCAAAGAAGGAGCTGAAGGAGGG - Intronic
1160455129 18:78994290-78994312 CCCAACACGCCGCTGCCGGAGGG + Exonic
1161666240 19:5578730-5578752 ACCAAGACGCCGTTGAGGGACGG - Intergenic
1161709286 19:5838761-5838783 CACACCACGCAGCAGAAGGAAGG + Exonic
1164890603 19:31820186-31820208 CACAAGACCCAGCTGGAAGAGGG - Intergenic
1165446444 19:35859475-35859497 CTCCAGACCCTGCTGAAGGAAGG + Exonic
1166848763 19:45747216-45747238 CCCATGATGCAGCTGAGGGAAGG - Intronic
926001006 2:9332363-9332385 GCCAAGACACACCTCAAGGAGGG + Intronic
928593599 2:32840405-32840427 CCAAAGAGGCAGCAGCAGGAAGG + Intergenic
929807933 2:45163420-45163442 CCCAATACGCAGCTGAGGATGGG + Intergenic
936797176 2:116220985-116221007 ACCCAGACGTAGCTGAAGGAAGG + Intergenic
938014714 2:127857923-127857945 CCCAAGCCGCCGCTGAGGCAGGG + Intronic
938161372 2:128987401-128987423 CCCCAGAGGCTGCTGAAGCATGG + Intergenic
938703587 2:133900515-133900537 ACCAAGAGGCAACTCAAGGAAGG - Intergenic
939828987 2:147050010-147050032 CCCAGGAAGCAGCTGAAGCTCGG - Intergenic
946201778 2:218074817-218074839 CCCAAGACCCAGGTGCAGGAGGG + Intronic
946309429 2:218874523-218874545 CCCAAGAGGAACCAGAAGGAAGG - Intergenic
948272527 2:236685637-236685659 ACAGAGAGGCAGCTGAAGGAGGG - Intergenic
1169345435 20:4824444-4824466 CCCAAAATGCAGCTGTAGGGTGG + Intergenic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG + Intergenic
1174575422 20:51533653-51533675 CCCCAGACGGGGCTGAAAGAAGG + Intronic
1174958362 20:55126936-55126958 CCCAGGAGGGAGCTGGAGGAAGG - Intergenic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1176028031 20:62996133-62996155 CTCAGGACGCAGCTCAATGACGG + Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1178146983 21:29751436-29751458 ACCAAGAGGCAGCTAAAGGAAGG - Intronic
1179138296 21:38699766-38699788 CCCAAGGGGCAGCTGAAGCGTGG + Intergenic
1180210275 21:46291635-46291657 CCCATGCCACAGTTGAAGGAGGG + Intronic
1184449142 22:44572676-44572698 CCCGAGACTCAGCTCAAGGTGGG + Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
950841237 3:15970184-15970206 CCCAAGGCGAAGAGGAAGGATGG - Intergenic
954755372 3:52836311-52836333 GCCAAGAGGCAGCTGAGGGCAGG + Intronic
961018424 3:123484589-123484611 CCCCAGTCACACCTGAAGGATGG + Intergenic
961445705 3:126980332-126980354 CCCAAGACGCAGCTGGAGACAGG + Intergenic
962708443 3:138066866-138066888 GCCACGGCGCACCTGAAGGAGGG + Intronic
963125501 3:141812251-141812273 CCAAAGAGGCAGCTGCAGGGAGG - Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976195426 4:82527429-82527451 CCCAAGAAGCATCTAGAGGAAGG - Intronic
976357714 4:84138597-84138619 CCCAAGTGGCAGCTCAGGGAAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984878934 4:184393479-184393501 CCCCAGTCGCAGGTGCAGGAGGG + Intronic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
991586801 5:68210322-68210344 CCAAAGACTCACCTGAAAGAAGG + Intergenic
1001044663 5:168362745-168362767 CTCAAGATGGAGGTGAAGGAAGG + Intronic
1005473367 6:26183853-26183875 ACCAAGGCGCAGAAGAAGGACGG + Exonic
1005475051 6:26199616-26199638 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1005476880 6:26216564-26216586 ACCAAGGCGCAGAAGAAGGATGG - Exonic
1005480603 6:26251708-26251730 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1011246119 6:85322966-85322988 CCCAAAATCCAGCTGAAGAATGG + Intergenic
1015102974 6:129503200-129503222 CCCAAGTCATAGCTGAAGTAGGG - Exonic
1016828099 6:148406608-148406630 CCCAAGAGACAGGTGAAGCAAGG + Intronic
1017354900 6:153492822-153492844 CCCTATAGGAAGCTGAAGGAAGG - Intergenic
1018776344 6:167020427-167020449 AACAAGACGCTCCTGAAGGATGG - Intronic
1021910601 7:25382510-25382532 CCCAATACACAGCTGTTGGAGGG + Intergenic
1030621547 7:111796069-111796091 CCCAGGGTGCAGCTAAAGGAGGG - Intronic
1034941603 7:155234245-155234267 CCCAAGAGGCAGCTGTGGCATGG + Intergenic
1036406001 8:8455782-8455804 TCCTAGATGCAGCTGATGGATGG + Intergenic
1037075518 8:14712247-14712269 TTCAGGACGGAGCTGAAGGAGGG - Intronic
1037696103 8:21225492-21225514 CCCAAGAGGCAGGTGAGGGCAGG + Intergenic
1038004190 8:23416227-23416249 TCAAAGATGCAGCTGAAAGAGGG + Intronic
1038938171 8:32275512-32275534 ATTAAGACGGAGCTGAAGGAAGG + Intronic
1043641930 8:82464540-82464562 CCCAAGACATTGTTGAAGGAGGG + Intergenic
1047628664 8:126682227-126682249 CACAAGAAGCAGCTGAATGTGGG - Intergenic
1048259502 8:132933862-132933884 CCCAAGATGAAGCTGGAGTAAGG + Intronic
1048368903 8:133759826-133759848 CCCAAGTCACAGCTGAGGGAAGG - Intergenic
1051043774 9:12848726-12848748 CCCATGAGGCAGATGAAGCATGG - Intergenic
1052896692 9:33753971-33753993 CCCAAGTTGCAGCAGAAAGACGG + Intronic
1052986108 9:34489396-34489418 CCAAAGACTCAGATGAAGGACGG + Exonic
1055861507 9:80755518-80755540 CACAAGAGGGAGCTGAAGTAGGG + Intergenic
1061971591 9:134048282-134048304 CCCAAGAAGGACCTGGAGGACGG - Exonic
1062114716 9:134802211-134802233 CCCAACACGCAGGGCAAGGAAGG + Intronic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185769773 X:2757000-2757022 CACACGAACCAGCTGAAGGATGG + Intronic
1187847700 X:23557767-23557789 CCCAGGACAAAGCTGAAGAAAGG - Intergenic
1190287396 X:48970551-48970573 GCCAAGAAGGAGCTGAGGGAGGG + Exonic
1195138612 X:101935437-101935459 CACCAAATGCAGCTGAAGGATGG - Intergenic
1201223207 Y:11791096-11791118 CCCAGGAAGCTCCTGAAGGAGGG + Intergenic