ID: 1151979344

View in Genome Browser
Species Human (GRCh38)
Location 17:77499397-77499419
Sequence CATCAGCAGCACCTGCAGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 1, 2: 4, 3: 65, 4: 568}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151979344_1151979349 9 Left 1151979344 17:77499397-77499419 CCGGGCTGCAGGTGCTGCTGATG 0: 1
1: 1
2: 4
3: 65
4: 568
Right 1151979349 17:77499429-77499451 CTGATTGAGGATAAAAAGGAAGG 0: 1
1: 0
2: 4
3: 19
4: 324
1151979344_1151979348 5 Left 1151979344 17:77499397-77499419 CCGGGCTGCAGGTGCTGCTGATG 0: 1
1: 1
2: 4
3: 65
4: 568
Right 1151979348 17:77499425-77499447 GGATCTGATTGAGGATAAAAAGG 0: 1
1: 0
2: 0
3: 23
4: 169
1151979344_1151979347 -4 Left 1151979344 17:77499397-77499419 CCGGGCTGCAGGTGCTGCTGATG 0: 1
1: 1
2: 4
3: 65
4: 568
Right 1151979347 17:77499416-77499438 GATGCGCTGGGATCTGATTGAGG 0: 1
1: 0
2: 0
3: 4
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151979344 Original CRISPR CATCAGCAGCACCTGCAGCC CGG (reversed) Exonic
900371364 1:2333597-2333619 CAGCAGCAGCACCTTGAGCCAGG - Intronic
900565201 1:3328767-3328789 CATACGCAGAATCTGCAGCCAGG + Intronic
901138162 1:7010939-7010961 CCTCACCAGCACCTGCACCTGGG - Intronic
901231331 1:7643082-7643104 CTTCAGAAGCACCTGGACCCTGG - Intronic
901495530 1:9619255-9619277 CATCTGGAGCTCCTGAAGCCAGG + Intergenic
902191335 1:14765369-14765391 CATCAGCTGGCCCGGCAGCCAGG + Intronic
902234293 1:15047830-15047852 ACTCAGCAGCCCCTGCAGCTGGG + Intronic
902234322 1:15047961-15047983 CAGCACCAGCAGCTACAGCCAGG - Intronic
902241815 1:15094804-15094826 GCTCAGCAGCACCTGCCCCCGGG - Exonic
902368131 1:15990472-15990494 CTCCAGGAGCACCTCCAGCCAGG + Intergenic
902612116 1:17603439-17603461 CATCTGCAGCACCTCTGGCCAGG + Intronic
904008710 1:27377858-27377880 CATGAGCAGCTCCTCCTGCCTGG - Intergenic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904037105 1:27564842-27564864 CAGCAGCAGCACCTGGTGCTTGG + Intronic
904093089 1:27958783-27958805 CATCAGCAGCAGCGGGAGCTGGG - Exonic
904286526 1:29456237-29456259 CACCTGCAGCAGCTCCAGCCAGG - Intergenic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
905247273 1:36623868-36623890 ACTCCGCACCACCTGCAGCCAGG - Intergenic
905522737 1:38612936-38612958 AATCCACAGCGCCTGCAGCCTGG - Intergenic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
905792698 1:40798807-40798829 CACGGGCAGCAGCTGCAGCCAGG - Intronic
905793696 1:40803496-40803518 CATCAGCTGGGCCTGCAGGCTGG + Intronic
905914568 1:41675845-41675867 CATCAGCAGAGCCTGTGGCCTGG - Intronic
906544540 1:46611994-46612016 CACCAGCCGCACCTGTAGCTGGG - Intronic
906943731 1:50277835-50277857 CATCCTCAGAACCAGCAGCCAGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
908102699 1:60807863-60807885 TAGCAGCAGCAGCTGCAGGCAGG + Intergenic
908421179 1:63959858-63959880 CACCAGCAGCCCCTTCAACCTGG + Intronic
908677142 1:66617991-66618013 CATGAGAAGCACCTGATGCCAGG - Intronic
908793782 1:67810992-67811014 CATCAGCATCACCTGGAAACTGG + Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
910847520 1:91617663-91617685 AAGCAGCAGCACCTGCAGGTCGG + Intergenic
911973176 1:104462416-104462438 AACCTGCAGCACCTGAAGCCTGG - Intergenic
913551277 1:119919329-119919351 CATCAGCTGCCACTGCAGCATGG + Exonic
914720765 1:150286912-150286934 CATCAGCAGCAACTGGAGGATGG - Exonic
915355796 1:155254770-155254792 CGTAAGCAGGGCCTGCAGCCAGG + Exonic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916668228 1:166987202-166987224 GATCAGCATTACCTGGAGCCCGG - Intronic
916804477 1:168244790-168244812 CTCCAGCAGCTCCAGCAGCCTGG + Exonic
917069574 1:171135485-171135507 CTTCAGCTGAACCTGCAGCTAGG + Intergenic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
918524665 1:185452357-185452379 CATAAGCAGACCCTTCAGCCGGG - Intergenic
919193148 1:194249029-194249051 GATCAGCTGCCCGTGCAGCCAGG + Intergenic
919787424 1:201268702-201268724 CCTCAGCAGCAGCTGCTGCAGGG + Intergenic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920076705 1:203342424-203342446 CAGGCGCAGCACCTGCAGCTTGG + Exonic
920076709 1:203342465-203342487 CATCAGCAGCTTCTGCACCGTGG - Exonic
920311621 1:205052125-205052147 GAGCAGCAGAATCTGCAGCCGGG + Intronic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
921029728 1:211326838-211326860 CAGCAGCCGCGCCTGCAGACCGG + Exonic
921384096 1:214551930-214551952 CAGAAGGAGCTCCTGCAGCCCGG - Intronic
922190141 1:223311407-223311429 CAGCAGCAGCACAGGCTGCCTGG - Intronic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
1062925923 10:1315234-1315256 CACCTGCAGCACCTGGTGCCTGG - Intronic
1063759447 10:9056769-9056791 CAGGAGCACCACATGCAGCCTGG - Intergenic
1064027984 10:11864241-11864263 CAGCAGCAACACCAGAAGCCGGG - Intronic
1064481253 10:15742994-15743016 AATCAGCAGCAACCGCAGACAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065881608 10:30042268-30042290 CACCCGCAGCACCTGCAGTGGGG + Intronic
1066627187 10:37418666-37418688 CAGCAGAAGCACCTGGACCCAGG + Intergenic
1067172731 10:43921576-43921598 CATTGGCAGCACCTGCATTCTGG + Intergenic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1069225653 10:65941250-65941272 CAAGAGCAGGATCTGCAGCCAGG + Intronic
1069624716 10:69860670-69860692 CCTGGGCAGAACCTGCAGCCAGG + Intronic
1069720615 10:70547425-70547447 CATCATCTGCACCTACCGCCAGG + Exonic
1069949126 10:72007423-72007445 CATGAGCAGCACGTGGCGCCGGG - Exonic
1070142873 10:73751713-73751735 CGTCAGCAGTACCTGTAACCTGG - Intronic
1070328956 10:75404698-75404720 CAGCCTCAGCACCTGAAGCCTGG + Intergenic
1070742898 10:78914067-78914089 CACCAGCAGCGGCAGCAGCCGGG - Intergenic
1070804368 10:79262235-79262257 CATCAGCAGCACCTGAGACCTGG + Intronic
1072540170 10:96392529-96392551 CACCAGCAGCACCAGCAGTAAGG + Intronic
1072570561 10:96654465-96654487 CCTCAGCAGCCCCAGGAGCCAGG - Intronic
1074363278 10:112839329-112839351 CAGCAGCTGCCCCTGCAGGCCGG - Intergenic
1074744567 10:116518925-116518947 CATAAGTAGCACTTGCATCCAGG + Intergenic
1075290261 10:121223530-121223552 CATTAGGAGCTCCTTCAGCCTGG - Intergenic
1075437388 10:122455108-122455130 CATCAGAAGCACCTGAAGGCTGG - Intronic
1075662369 10:124206909-124206931 GCTCAGCTTCACCTGCAGCCAGG - Intergenic
1075715576 10:124553348-124553370 CACCCCCTGCACCTGCAGCCAGG + Intronic
1076005328 10:126944230-126944252 GACCAGCAGCCCCTGCATCCAGG - Intronic
1076096449 10:127737548-127737570 CCTCAGCAGCTCCTGCTGGCCGG - Exonic
1076526820 10:131117290-131117312 CTGCAGCAGCACCTGAGGCCTGG - Intronic
1076712508 10:132346173-132346195 CATCAGCAGCCGCTGGTGCCTGG - Intronic
1076786022 10:132750449-132750471 CAACAGCAGGTCCAGCAGCCGGG - Intronic
1077021647 11:419704-419726 GGTCTCCAGCACCTGCAGCCAGG + Exonic
1077074095 11:692219-692241 CTTCAGCAGCATCTGCACACAGG + Intronic
1077864271 11:6210283-6210305 CGTCAGCCCCAGCTGCAGCCAGG - Exonic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078426088 11:11252599-11252621 CATCACCAGCAGGTGCAGACGGG - Intergenic
1079160210 11:17985436-17985458 CATTAAAAGCACCTCCAGCCAGG + Intronic
1079324624 11:19481026-19481048 GATCCGTAGCACCTGCAGCCCGG + Intronic
1079410245 11:20180762-20180784 CATCAGCATCACTTGGAGGCTGG - Intergenic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1080089659 11:28331027-28331049 GAGCAGCAGCACCTCCAGACTGG + Exonic
1080457119 11:32427984-32428006 CGACAGCTGCACCGGCAGCCAGG - Exonic
1080648801 11:34206757-34206779 CATCAGCTGAACCTGCAGAACGG - Intronic
1081702519 11:45161129-45161151 TAACAGCAGCACCTACATCCTGG + Intronic
1082987745 11:59182580-59182602 CACCACCTTCACCTGCAGCCAGG - Intronic
1082996943 11:59262393-59262415 CTCCAGCAGCAGCTGCACCCTGG - Intergenic
1083431844 11:62617272-62617294 CACCAGCAGCCAATGCAGCCGGG + Exonic
1083661821 11:64254941-64254963 CATCAGCTTCTCCTCCAGCCGGG - Exonic
1083853964 11:65383070-65383092 CAGCAGCATCAGCGGCAGCCTGG + Intronic
1083950359 11:65951771-65951793 CAGCAGGATCACCTGAAGCCAGG - Intronic
1084213760 11:67635731-67635753 CTTCAGCAGCACCGGGAGGCAGG - Intronic
1084427759 11:69094854-69094876 CCCCAGCAGCACCTGTTGCCAGG + Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084898602 11:72293557-72293579 TATGAGCAGGACCTGCTGCCAGG - Exonic
1084939894 11:72606931-72606953 CATCAGCACCATCTGCATTCGGG + Intronic
1085535477 11:77214756-77214778 CATCAGCTACCCCTGCAGCTGGG + Exonic
1086850699 11:91804154-91804176 CAGCAGCAGAGGCTGCAGCCAGG + Intergenic
1086949375 11:92876051-92876073 CATCAGAAGCACCTGGGGGCAGG - Intronic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1088233702 11:107700181-107700203 CAACAGCAGCAATTCCAGCCAGG - Intergenic
1089278517 11:117356011-117356033 CAGCAGCAGCAACAGCAACCTGG + Intronic
1089505363 11:118958614-118958636 GACCAGGAGCACCTGCAGCTTGG - Intergenic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1090392000 11:126394812-126394834 CACCATCCGCCCCTGCAGCCTGG - Intronic
1090420594 11:126572581-126572603 CATCAGCAGCACCTGCTTGGCGG - Intronic
1090844908 11:130522430-130522452 CATCAGGAGGGCCTGGAGCCTGG - Intergenic
1091271180 11:134312978-134313000 GAGCAGCAGCACCAGCAGCAGGG - Intronic
1091320275 11:134644660-134644682 ACACAGCAGCACCTGCTGCCCGG + Intergenic
1093119659 12:15253560-15253582 TAGCAGCAGCAGCTGCTGCCTGG + Intronic
1094284330 12:28775621-28775643 CAGCTGCTGCACCTTCAGCCTGG - Intergenic
1095143158 12:38691917-38691939 CATTAGCAGCACCTGAACTCTGG + Intronic
1095945157 12:47749525-47749547 GGTCACCAGCCCCTGCAGCCAGG + Exonic
1096180254 12:49546715-49546737 CATCAGCAACCCCTGAAGCTGGG - Intronic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1098893277 12:76031125-76031147 CAGCAGCAGCAACAACAGCCCGG - Exonic
1102178463 12:110893610-110893632 GATCAACAGCACCTGCCACCAGG - Intronic
1102231674 12:111266873-111266895 CATCAGCCTCACCTGCAAGCTGG + Intronic
1102349849 12:112184327-112184349 CCTGTGCAGCACCGGCAGCCTGG - Exonic
1102438526 12:112944139-112944161 AGTCAGCAGTGCCTGCAGCCTGG - Intronic
1102824924 12:115941037-115941059 CATCTGCAGCCCCAGCACCCTGG + Intergenic
1102828048 12:115967388-115967410 AATCCTGAGCACCTGCAGCCAGG - Intronic
1102913733 12:116737789-116737811 CCTCAGCAGCACCTTCAAGCAGG - Exonic
1102929686 12:116852639-116852661 CTTCAACAGCATCTGCAGGCAGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103082528 12:118036594-118036616 AATCTGCAGGCCCTGCAGCCAGG + Intronic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104125600 12:125842693-125842715 CAGCAGCAGCACTTGATGCCAGG + Intergenic
1104685224 12:130780516-130780538 CACCAGCGACTCCTGCAGCCTGG + Intergenic
1104881871 12:132077441-132077463 GATCATCTGCACCTGCTGCCCGG - Exonic
1105424349 13:20282407-20282429 CAGCAGCTGCAACTGCAACCGGG - Intergenic
1106123732 13:26882995-26883017 CTCCAGCAGGACCTGGAGCCTGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106568492 13:30906630-30906652 CAGCTGCTGCGCCTGCAGCCCGG + Exonic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1110158794 13:72351177-72351199 CATCAGCAGGAGCTGGTGCCAGG - Intergenic
1110879775 13:80557781-80557803 CATCAGAATCACCTGAACCCGGG - Intergenic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1113242778 13:108358032-108358054 AAAAAGAAGCACCTGCAGCCTGG - Intergenic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114536342 14:23425383-23425405 CTCCAGCAGCCCCAGCAGCCCGG + Exonic
1114648007 14:24266440-24266462 CAGTAGCAGCTCCTGCAGCCGGG + Exonic
1114802370 14:25792063-25792085 GATCAGCAGCACCTGCATCTTGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1117868196 14:60171061-60171083 CCACTGCAGCACCTCCAGCCTGG + Intergenic
1118447212 14:65862883-65862905 CAGCAGCAGCACCTAGGGCCTGG + Intergenic
1118678292 14:68212431-68212453 CAACAGCAGCACCAGCAGCAAGG + Intronic
1119028553 14:71173845-71173867 CAGCACCAGCACCTGCCACCTGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119420148 14:74503469-74503491 CATGAACAGCACCAGCAGCACGG - Exonic
1119659730 14:76441709-76441731 TATCACCAGCACCTACAGCCTGG - Intronic
1119712101 14:76829775-76829797 CAGCAGGAGCACCAGGAGCCAGG - Intronic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121046539 14:90792278-90792300 CATCAGCAGCAACTGGGGGCAGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121612542 14:95291486-95291508 CCCCAGCCGCACCTGCAACCTGG - Intronic
1121738893 14:96237705-96237727 CATAGGCAGCACCTGCAGCAGGG - Intronic
1121784791 14:96649348-96649370 CATTGGCAGCAGCTGCAGGCAGG + Intergenic
1122143512 14:99675897-99675919 CACCAGCAGGAACAGCAGCCGGG + Exonic
1122937553 14:104967059-104967081 CCCCAGCTGCACCTGCTGCCAGG - Intronic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123626157 15:22228120-22228142 CAACAGCAGGACCTGGAGGCAGG - Intergenic
1123724510 15:23088659-23088681 CATCAGCTGGGCGTGCAGCCTGG - Intergenic
1124064958 15:26333729-26333751 CTTCTGCTGCACCTGCATCCTGG - Intergenic
1124345616 15:28919642-28919664 CATCAGCACACCCTGCAGCGGGG + Intronic
1124650592 15:31470903-31470925 CATGAGCTGCACCTGCAAGCTGG + Intergenic
1124896611 15:33783241-33783263 CACCAGCATCACCTGGAGACCGG - Intronic
1125435960 15:39645660-39645682 GGGCAGCAGCAGCTGCAGCCAGG - Intronic
1125598581 15:40903097-40903119 CCTCTGCAGCTCCTCCAGCCGGG - Exonic
1125768559 15:42150629-42150651 CATCAGCTCCACGTGTAGCCTGG + Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126038526 15:44569529-44569551 CATCAGCATCACCTGGAGTCTGG + Intronic
1127377472 15:58398179-58398201 GGTAAGCAGCCCCTGCAGCCAGG - Intronic
1129053440 15:72801602-72801624 CTTGTGCAGCTCCTGCAGCCTGG + Intergenic
1129605724 15:77024129-77024151 CATCAGCAGCGCTTGGGGCCGGG + Intronic
1129880472 15:79003394-79003416 CGTCAGCAGCTCCTGCCCCCTGG - Intronic
1129906917 15:79194969-79194991 CATCAGCTGCACCTGATGACAGG + Intergenic
1130886438 15:88096442-88096464 CCTCAGCAGCACCTGCCTCTGGG - Intronic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1131072732 15:89476384-89476406 CATCAGCATCACCTACAGACTGG - Intronic
1131260919 15:90887300-90887322 CACCACCAGCTCCTGCTGCCCGG + Exonic
1131558503 15:93419686-93419708 CAGCAGCAGCACTTCCCGCCTGG - Intergenic
1131969048 15:97874240-97874262 AATAAACAGCACCGGCAGCCTGG - Intergenic
1132026094 15:98405537-98405559 GAGCAGCAGCAACAGCAGCCTGG - Intergenic
1132085667 15:98906539-98906561 CAGCAGTGTCACCTGCAGCCTGG + Intronic
1132590594 16:724735-724757 CTTGAGCTGCAGCTGCAGCCGGG + Exonic
1132650181 16:1017700-1017722 CCTCACCAACACCTACAGCCTGG + Intergenic
1132665782 16:1080741-1080763 CATCTGCACCCCCAGCAGCCTGG - Intergenic
1132683196 16:1152274-1152296 CAGCAGCTGCTCCTTCAGCCAGG - Intergenic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133313720 16:4868829-4868851 CCTCAGCAGCTCTGGCAGCCTGG - Exonic
1136297571 16:29312438-29312460 CATCAGCACCAACTGCCGCACGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138281055 16:55772551-55772573 CATCAGCATCACATCAAGCCTGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139486149 16:67257631-67257653 CAGCAGCAGCCCCACCAGCCAGG + Intronic
1139918073 16:70440141-70440163 CATGAGCAACACCTGGAGACGGG - Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140472939 16:75225175-75225197 CATCCTCAGCACCTGCCCCCAGG + Intergenic
1140504838 16:75464680-75464702 CCTCAGCGTCACCTCCAGCCGGG + Exonic
1141389499 16:83652743-83652765 AATCCCCAGCGCCTGCAGCCTGG + Intronic
1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG + Intergenic
1141977819 16:87529250-87529272 CACCAGCAGGACCTGGAGGCAGG + Intergenic
1142059124 16:88018516-88018538 CATCAGCACCAACTGCCGCACGG + Exonic
1142148138 16:88501085-88501107 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148150 16:88501136-88501158 CATCACCAGCACCTGCGGGATGG - Intronic
1142148162 16:88501187-88501209 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148189 16:88501289-88501311 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148201 16:88501339-88501361 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148213 16:88501389-88501411 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148225 16:88501440-88501462 CATCACCAGCACCTGCGGGATGG - Intronic
1142148234 16:88501491-88501513 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148244 16:88501542-88501564 CATCACCAGCACCTGCGGGATGG - Intronic
1142148302 16:88501795-88501817 CATCACCAGCACCAGCGGCAGGG - Intronic
1142287841 16:89178660-89178682 GACCAGCAGCAGCTGCAGGCCGG + Intronic
1142311593 16:89317370-89317392 AGTCAGCAGCACCTGGATCCTGG + Intronic
1142429044 16:90016565-90016587 CACCAGCAGCCCCTGCAGGGGGG - Intronic
1143109319 17:4544635-4544657 CAGGTCCAGCACCTGCAGCCAGG + Exonic
1143123707 17:4626868-4626890 GATCATCAGCACCTCCAGCTAGG - Intergenic
1143164384 17:4890643-4890665 CAGCAGCAGCAGCTCCTGCCTGG + Exonic
1143185052 17:5004947-5004969 CATCAGCAGTTCCCGCAGCCGGG - Exonic
1143271752 17:5680958-5680980 CATCAGCAGCACTACCTGCCTGG - Intergenic
1143426438 17:6843004-6843026 GATCATCAGCACCTCCAGCTGGG + Intergenic
1143586175 17:7851656-7851678 CTTCAGCAGCTCCTGCAGCTGGG - Exonic
1143760339 17:9098315-9098337 CTCCAGCAGTGCCTGCAGCCAGG + Intronic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG + Intergenic
1144600619 17:16609313-16609335 TATAAGCAGCATCTACAGCCTGG - Intergenic
1144643177 17:16950666-16950688 CAACAGCACCACCTGCAACAGGG - Intronic
1144814604 17:18025253-18025275 CAGCAGCTGCATCTGTAGCCAGG - Intronic
1144992579 17:19243857-19243879 CATCAGCAGCACTTGGAAGCTGG - Intronic
1146269232 17:31473650-31473672 CATCAGCAGTCCTGGCAGCCTGG - Intronic
1146590837 17:34126849-34126871 CATCAGCATCACCTGGAAGCTGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147392302 17:40117582-40117604 CATGAGGATCACCTGAAGCCAGG - Intergenic
1147613158 17:41813078-41813100 CAGTAGCAGCAACTGCAGCAGGG - Exonic
1147906467 17:43826373-43826395 CATCAGCATCACCTGGAGGCAGG + Intronic
1147931952 17:43987327-43987349 CATCAGAAGCAGCTGCCTCCAGG + Intronic
1148119248 17:45197962-45197984 CAACAGCGGCACCTGCCGGCTGG + Intergenic
1148807135 17:50269593-50269615 CATCGGCACCCCGTGCAGCCTGG - Intergenic
1149655136 17:58305910-58305932 GCGCTGCAGCACCTGCAGCCTGG - Intronic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151681456 17:75624895-75624917 CATCAGCACCCACTACAGCCAGG + Intergenic
1151835175 17:76578077-76578099 TATCGGCAGCACATGGAGCCAGG + Intronic
1151927840 17:77211844-77211866 CAGCTTCAGCACCTGCACCCTGG + Intronic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152071645 17:78137154-78137176 CATCAGCCACACCTATAGCCTGG + Intronic
1152285254 17:79408986-79409008 CATCACCAGCCCCTGCCACCTGG + Intronic
1152293917 17:79455830-79455852 CTGCAGCGGCACCTCCAGCCTGG + Intronic
1152427484 17:80226040-80226062 CATCAGCAGCACCTGCAAGCTGG + Intronic
1152441242 17:80311548-80311570 TCACAGCAGCACCTGCATCCTGG + Intronic
1152575339 17:81137530-81137552 CATCAGAGGCACCTGCTACCTGG + Intronic
1152600899 17:81261695-81261717 CCTCAGCAGCACCTGGCGTCCGG - Intronic
1152662151 17:81547470-81547492 GAACAGCAGCAGCTTCAGCCTGG - Exonic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152759344 17:82099795-82099817 GATCACCAGCACTGGCAGCCAGG - Intergenic
1152809487 17:82374842-82374864 CAGCAGCAGCGCCAGCAGCCAGG - Exonic
1153410774 18:4789934-4789956 TATCAGCTGCATCTGCAGCATGG - Intergenic
1153783680 18:8515780-8515802 TATCAGCAGCTCCTGGAGCCTGG - Intergenic
1154068596 18:11131984-11132006 ACTCAGCAGCGGCTGCAGCCAGG - Intronic
1157306436 18:46520966-46520988 CATCCGCAGGCGCTGCAGCCTGG - Intronic
1158920589 18:62187295-62187317 CCTCTGCTGCACCAGCAGCCCGG - Exonic
1159484508 18:69037508-69037530 CATCAGTATCACCTGGAGACTGG + Intronic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160059150 18:75514034-75514056 CATCAACAGCCCCAGGAGCCCGG + Intergenic
1160609519 18:80074417-80074439 CATCAGCAGCAGCTCCAGGCTGG - Intronic
1161068907 19:2250867-2250889 GAACAGCAGTGCCTGCAGCCGGG - Exonic
1161133161 19:2603666-2603688 CATCAGAAGCCCCTGCAGCTAGG + Intronic
1161975622 19:7606528-7606550 CTCCAGCAGCCCCTGCAGACGGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162943808 19:14030720-14030742 CTTCATCAGCATCTGCATCCGGG - Exonic
1164663678 19:30005647-30005669 CAACAATATCACCTGCAGCCTGG - Exonic
1164918615 19:32071916-32071938 CAGCAACAGCACCTGGGGCCAGG + Intergenic
1165300389 19:34964516-34964538 CATCAGCATCACCTGGGGACTGG + Intergenic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1166783934 19:45356712-45356734 CATCAGAATCACCTGAATCCAGG + Intronic
1167011703 19:46813107-46813129 CATCAGAGGCAGCTGGAGCCGGG + Intergenic
1167095443 19:47372913-47372935 CACCAGCCTCACCTGCACCCAGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
925470290 2:4153713-4153735 AAACAGCAGCAGCAGCAGCCTGG - Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927298672 2:21484848-21484870 CCTAAGCAGGACCTACAGCCCGG - Intergenic
927854033 2:26516813-26516835 CAGCAGCGGGACCTGGAGCCAGG - Intronic
928195899 2:29216233-29216255 CATGGGGAGCACCTGCAGCAAGG - Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928552317 2:32384677-32384699 AATCAGCAACAGCTGTAGCCTGG + Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929797386 2:45070619-45070641 CAAGACCAGCACCAGCAGCCAGG - Intergenic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930716104 2:54595561-54595583 GAGCAGCAGCACCAGCAGCATGG - Intronic
930750696 2:54931468-54931490 CATCAGGACCACATGAAGCCAGG + Intronic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932000380 2:67879342-67879364 CATCAGCATCACCTGGAAACAGG - Intergenic
932405600 2:71511069-71511091 CCTCAGCAGGATCTGCAGCCTGG - Intronic
932417798 2:71584224-71584246 CATCAGCCTCTCCTGCAGCTTGG + Intronic
932828955 2:74969629-74969651 AAGCAGCAGCAGCTGCATCCAGG - Exonic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933926420 2:87094307-87094329 TCTCAGCAGCAGCCGCAGCCTGG - Intergenic
934038631 2:88109508-88109530 CATCAGCAGCACCATTTGCCAGG - Intronic
936088158 2:109483783-109483805 CAACCCCAGCGCCTGCAGCCTGG - Intronic
936247698 2:110842968-110842990 CCTCAGCAGCTGCAGCAGCCTGG - Intronic
936758908 2:115749851-115749873 CCCCAGCATCACCTGCAGACAGG - Intronic
937321785 2:120965398-120965420 CTGCTGCAGCACCTGCATCCTGG - Intronic
937321842 2:120965664-120965686 CTGCCGCAGCACCTGCATCCCGG - Intronic
937335769 2:121061556-121061578 CCTCAGGATCACCTGCAGTCAGG - Intergenic
937851388 2:126639397-126639419 CATCAGCAGAACATGCAGGTAGG + Intergenic
937896482 2:126980126-126980148 CATCAGGCCCACCTCCAGCCAGG + Intergenic
938228489 2:129637757-129637779 CCTCAGCAGCCTCTGCTGCCTGG + Intergenic
939162030 2:138602079-138602101 CAGCAGCATCACCATCAGCCTGG - Intergenic
942453517 2:176122909-176122931 CATCAGCCACACCTGCAGGCCGG - Exonic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
945412196 2:209523566-209523588 AAGCAGCAGCTCCTGCAGGCTGG - Intronic
946185933 2:217980327-217980349 CCTCAGCACCACCACCAGCCCGG + Intronic
946310735 2:218881153-218881175 CATCAGAGGCCCCTGCAGGCCGG - Intronic
946483566 2:220079288-220079310 CATCACCAGCAGGTACAGCCTGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947156223 2:227164746-227164768 CAGCAGGAGCACCTGCGGCCTGG - Exonic
947944755 2:234092020-234092042 CGTCAGCAGCTGCAGCAGCCAGG - Intergenic
948113171 2:235473321-235473343 CATCAGCAGGTGCTGCACCCAGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948805635 2:240452606-240452628 CAGGAGCAGCACCCGCAGGCGGG + Intronic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169235045 20:3924189-3924211 TACCAAGAGCACCTGCAGCCTGG - Intronic
1169844103 20:9971117-9971139 AATCAGCAGCACCTGTTACCTGG - Intergenic
1169873320 20:10270378-10270400 CTTCAGCATCACCTGAAGGCTGG + Intronic
1170749210 20:19130488-19130510 CGTGAGCTGCACCTGCAGCCAGG - Intergenic
1170986763 20:21266095-21266117 CATCTGCAGCACATGCAGCAAGG + Intergenic
1171361724 20:24590680-24590702 GATAGGCAGCACCTGCAGCGGGG + Intronic
1171376496 20:24697567-24697589 CAGCAGCCTCCCCTGCAGCCAGG + Intergenic
1171401032 20:24873070-24873092 AAGCAGCAGCGCCTCCAGCCTGG - Intergenic
1172008907 20:31835110-31835132 CATGAGAATCACCTGAAGCCGGG - Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172233575 20:33353802-33353824 CACCAGCTGCACCAGCACCCAGG + Intergenic
1172483500 20:35285305-35285327 TCTCTCCAGCACCTGCAGCCTGG - Intergenic
1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG + Intronic
1173453266 20:43184295-43184317 CATCAGATGCACCTTCAGACTGG - Intronic
1173461652 20:43247909-43247931 CAGCAGCACCCCCGGCAGCCCGG + Intergenic
1173906687 20:46634710-46634732 CACCAGGAGCTCCTGCATCCAGG - Intronic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175177421 20:57120571-57120593 CATCAACACCCCCAGCAGCCTGG - Intergenic
1175338824 20:58214574-58214596 CTCCAGCAGCCTCTGCAGCCGGG - Intergenic
1175791862 20:61744968-61744990 CAACAGCTGGACCTGCAGGCTGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175900769 20:62359107-62359129 CACCTGTAGCACCTGCAGCGTGG + Intronic
1175954993 20:62604650-62604672 CATCAGTGGGACCTGCAGCCGGG + Intergenic
1176089419 20:63312329-63312351 CAGGCCCAGCACCTGCAGCCAGG - Intronic
1176726375 21:10438019-10438041 CATGAGCATCACCTGAACCCAGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1179156236 21:38853522-38853544 CAGCTGCAGCACCTGCTCCCTGG + Intergenic
1179433403 21:41341949-41341971 CATCAGCAGAACATGCAGGAGGG - Intronic
1179550514 21:42140749-42140771 GAGCAGCAGCACCTGCCTCCCGG - Intronic
1179632892 21:42689425-42689447 CCTCAGCACCAGCTCCAGCCTGG + Intronic
1179647288 21:42783825-42783847 AAGCAGCACCGCCTGCAGCCTGG + Intergenic
1180127286 21:45801119-45801141 CACCTGCAGCACCCACAGCCTGG + Intronic
1180959776 22:19757278-19757300 CCTGAGCAGGACCTGCAGGCAGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181863885 22:25840320-25840342 CTTCAGCAGCTCCTTCTGCCTGG + Intronic
1182053001 22:27327635-27327657 CACCTGCTGCGCCTGCAGCCTGG - Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1183166349 22:36149897-36149919 CAGAAGCATCACTTGCAGCCAGG - Intronic
1183744809 22:39686189-39686211 GTTCAGCAGCACCAGCAGCCTGG + Exonic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1183931486 22:41238289-41238311 CAGCAGCAGCTCCCGCAGGCCGG + Exonic
1184073786 22:42163312-42163334 GTTCCTCAGCACCTGCAGCCTGG + Intronic
1184088648 22:42281082-42281104 CAGGAGCAGCTCCTCCAGCCTGG - Intronic
1184267829 22:43359185-43359207 TCCCAGCTGCACCTGCAGCCTGG - Intergenic
1184292040 22:43502556-43502578 TAGCAGCAGCTTCTGCAGCCTGG - Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184301938 22:43566589-43566611 CATCTCCAGCACCTGCTGGCAGG - Intronic
1184376398 22:44116579-44116601 CAGCACCAGCACTTGCTGCCTGG - Intronic
1184510382 22:44929938-44929960 CCCCTGCAGCACCTGCAACCAGG + Intronic
1184596815 22:45518909-45518931 CCACTGCAGCACCCGCAGCCTGG - Intronic
1184601605 22:45547098-45547120 CAGCAGCAGCCCCTGTAGCCAGG + Exonic
1184790684 22:46697983-46698005 CAGCAGCAGCCCCGGGAGCCTGG + Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185267817 22:49913712-49913734 CACCAGCAGCCCCAGCAGCAGGG + Exonic
1185310390 22:50151044-50151066 CGTCAGCAGAAACTGCAGCCTGG + Intronic
950838395 3:15942615-15942637 CAGCAGCACTCCCTGCAGCCAGG - Intergenic
951670021 3:25170477-25170499 CATCAGCATCACCAGCAAACTGG - Intergenic
951680739 3:25292118-25292140 CATCAGCAACCCCTGAAGCAGGG - Intronic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
953854267 3:46488937-46488959 GGTCTGCTGCACCTGCAGCCTGG + Intergenic
954040664 3:47884912-47884934 CATCACCAGCAACTGCAGGGAGG - Intronic
954206532 3:49063281-49063303 CAACAGCAGCAGCAGCATCCAGG + Intronic
954532689 3:51334428-51334450 CTTCAGCAGCAACTGGATCCAGG - Intronic
954659269 3:52218263-52218285 CATCAGAGGCACATGCAGCTGGG - Intergenic
954667207 3:52262483-52262505 CATCAGCATCACCTGGAGGGTGG + Intronic
954675235 3:52311912-52311934 CATGGGCAGCACCTGCTCCCTGG + Intergenic
954693098 3:52406286-52406308 CACCTTCAGCACATGCAGCCTGG + Exonic
954715354 3:52524096-52524118 CATCAGCATCATCTTCCGCCTGG - Exonic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955971064 3:64439040-64439062 CCTCTGCAGCAACTGCATCCCGG + Intronic
956724432 3:72145571-72145593 CATGAACAGCACATGCAGACTGG + Intergenic
957028117 3:75208547-75208569 CAGCAGCATCACCTGAAGCCTGG - Intergenic
957486701 3:80871019-80871041 CATCTGCAGAACTGGCAGCCTGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959484277 3:106908955-106908977 CATCAGCAGGACTGGCATCCTGG - Intergenic
961127725 3:124435635-124435657 CATCAGAGGGCCCTGCAGCCAGG + Intronic
961449065 3:126994341-126994363 CAGCAGCAGCACTCCCAGCCAGG - Intronic
962637838 3:137349115-137349137 GAGCAGCAGCAGCTGCTGCCTGG + Intergenic
962847941 3:139287438-139287460 CAGCAGCAGCACCTGGAAACTGG - Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964441282 3:156713677-156713699 GAGCAGCAGCACCTCCAGACTGG - Intergenic
966427850 3:179799550-179799572 CAGCAGCTGAATCTGCAGCCTGG - Exonic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
968872020 4:3247052-3247074 CAGCAGCTGCCCCTTCAGCCAGG + Intronic
969617639 4:8262812-8262834 CACCAGCAGCACCCACAGCTGGG + Intergenic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970584182 4:17499690-17499712 CAGGAGCATCACCTGAAGCCAGG + Intronic
971100889 4:23465519-23465541 ACTCAGCAGTAGCTGCAGCCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973759110 4:54100756-54100778 CATCATCAGCCCCAGCAGCCTGG + Exonic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
976198522 4:82557350-82557372 CTTCAGCTGCTCCTGGAGCCAGG + Intronic
976511191 4:85911116-85911138 CTGCAGCTGCACCTGCACCCAGG + Intronic
979727785 4:123985064-123985086 CATCATCAGCAGCTGCTGCAGGG + Intergenic
979891251 4:126097849-126097871 CAGAAGCAGCTCCTGAAGCCAGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
983064017 4:163189668-163189690 AGGCAGCACCACCTGCAGCCCGG - Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983632868 4:169867272-169867294 CAGCAGCAGCAATTCCAGCCAGG - Intergenic
984134418 4:175917376-175917398 CAGCAGCAGCATCTGTAGCAGGG - Intronic
984839190 4:184052299-184052321 CCAGAGCATCACCTGCAGCCCGG + Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
986136322 5:4982430-4982452 CATCAGCATCACCTGGAAACTGG + Intergenic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
987162263 5:15156437-15156459 CATCAGCAGTTCCTTCAGCATGG + Intergenic
988527762 5:32001491-32001513 CATCAGCAGCGCCAGGACCCGGG + Intronic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
992233469 5:74685295-74685317 CAACAGCAGCGCCAGCAGCATGG - Exonic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996841685 5:127853474-127853496 CATCAAAAGCACCTGGAGGCTGG + Intergenic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998307867 5:141096763-141096785 CACCAGGAGCACGTGCAGCGTGG - Exonic
998308502 5:141102616-141102638 CACCAGGAGCACATGCAGCGTGG - Exonic
998310408 5:141123962-141123984 CACCAGGAGCACGTGCAGCGTGG - Exonic
998311566 5:141137398-141137420 CACCAGGAGCACGTGCAGCGTGG - Exonic
998312848 5:141152218-141152240 CACCAGGAGCACGTGCAGCGTGG - Exonic
998313542 5:141157967-141157989 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998315036 5:141174802-141174824 CACCAGGAGCACGTGCAGCGTGG - Exonic
998315613 5:141180004-141180026 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316153 5:141184526-141184548 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316711 5:141189285-141189307 CACCAGGAGCACGTGCAGCGTGG - Exonic
998318016 5:141201741-141201763 CACCAGGAGCACTTGCAGCGTGG - Exonic
998318975 5:141210874-141210896 CACCAGGAGCACGTGCAGCGTGG - Exonic
998319540 5:141216090-141216112 CACCAGGAGCACGTGCAGCGTGG - Exonic
998320517 5:141225472-141225494 CACCAGGAGCACGTGCAGCGTGG - Exonic
998321530 5:141236521-141236543 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998322090 5:141241877-141241899 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998322756 5:141247545-141247567 CACCAGGAGCACTTGCAGCGTGG - Exonic
999132968 5:149298801-149298823 CACCAGCATCAGCTGCAGCTTGG + Intronic
999626674 5:153528568-153528590 CATCAGCATCACCTGGAACTTGG - Intronic
1002065682 5:176650599-176650621 CATCAGCAGACCCAGCAGGCAGG + Intronic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002424233 5:179166235-179166257 CCACAGCAGCACCGGGAGCCTGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002596677 5:180328374-180328396 CAGCAGCCGCTGCTGCAGCCTGG + Intronic
1002787276 6:412026-412048 TAGCACCAGCAGCTGCAGCCTGG - Intergenic
1003190861 6:3873193-3873215 CAGGAGCAGCACATTCAGCCTGG - Intergenic
1003307679 6:4944507-4944529 TAACAGCAGCACCCGCAGCCAGG + Intronic
1004140617 6:13014099-13014121 CATTTGCAGCAACTGCAGTCGGG + Intronic
1006009770 6:31032527-31032549 CAGCAGCCACAACTGCAGCCAGG - Exonic
1006364975 6:33610004-33610026 CAGCCCCAGCACCTGCTGCCTGG + Intergenic
1006434909 6:34021010-34021032 CATAGGCAGCAGCTGGAGCCTGG - Intronic
1006635325 6:35457566-35457588 CTTCAGCAGCTGCTGCAGCCTGG - Exonic
1006899791 6:37492683-37492705 CATCTCCAGCCCCAGCAGCCTGG + Intronic
1007224457 6:40303091-40303113 CACTTGCAGCACCTGCAGCCAGG + Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007791795 6:44313294-44313316 CGTCAGTGGCAGCTGCAGCCCGG - Exonic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1009947091 6:70352711-70352733 CATCTGCAGCAACTGCCACCAGG + Intergenic
1010491177 6:76477684-76477706 CATAAGCAGCACCTATGGCCAGG + Intergenic
1011108878 6:83814109-83814131 CATCGCCAGCACCTGCACCAAGG - Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1015347491 6:132176784-132176806 CAACAGCAGCAACCGAAGCCAGG + Intergenic
1015823230 6:137284633-137284655 CCCCAGCTGCACATGCAGCCTGG + Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1017043200 6:150324272-150324294 CATCTGCAGAAGCTGCTGCCAGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018694119 6:166377229-166377251 CAGCAGCAGCACCAGCTTCCAGG - Intronic
1018720035 6:166565447-166565469 CACCAGCAAAGCCTGCAGCCAGG - Intronic
1018731826 6:166657112-166657134 CACCAGCCGCACCTGGCGCCAGG + Intronic
1019378284 7:707897-707919 CACCAGCACCACCTGGAGCCGGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019723892 7:2590076-2590098 CAGCAGCTGCTCCTGCAGCGCGG - Exonic
1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG + Intergenic
1020270474 7:6591857-6591879 CTTGAGCAGTACCTGAAGCCAGG - Exonic
1020987777 7:15157525-15157547 TATCACCAGGACCTGCAGCCTGG - Intergenic
1021684178 7:23165883-23165905 CTTCTGCAGCACATGCAGCAAGG - Exonic
1022836577 7:34122274-34122296 CATCAGCATCACCAGGAGCTAGG - Intronic
1023225510 7:37964917-37964939 CATCAGCATCACCTGGAAGCTGG - Intronic
1023844104 7:44111539-44111561 CATCACCCGCACTTACAGCCTGG + Exonic
1024377746 7:48658266-48658288 CAGCAACAGGACCTGGAGCCTGG + Intergenic
1026482433 7:70790315-70790337 CATGAACAGCATCAGCAGCCTGG + Exonic
1026735804 7:72947931-72947953 CCTCAGCTGCACACGCAGCCAGG - Intronic
1026786147 7:73302862-73302884 CCTCAGCTGCACACGCAGCCAGG - Intronic
1027107930 7:75417132-75417154 CCTCAGCTGCACACGCAGCCAGG + Exonic
1027187273 7:75979937-75979959 CATCAACTGCAAATGCAGCCTGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1032017988 7:128392067-128392089 ACTCAGCAACTCCTGCAGCCAGG - Intergenic
1032313081 7:130806571-130806593 CCTCAGCATCACCTGCAAACTGG - Intergenic
1032536113 7:132665987-132666009 CATCAGCAGCTTCTCCAGGCAGG - Intronic
1033238748 7:139659480-139659502 CACAAGCTGCAGCTGCAGCCGGG - Intronic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034446571 7:151116864-151116886 CATGGGCAGCACCGGCGGCCTGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035448196 7:158957302-158957324 CAGGAGCAGCCCCAGCAGCCGGG - Intergenic
1036453805 8:8891814-8891836 CATCAGGAGCAGCTTGAGCCGGG + Exonic
1037573717 8:20180887-20180909 CACCACCAGCACCAGCTGCCGGG + Exonic
1038384514 8:27129699-27129721 CATCACCAGCAACTCCACCCTGG - Intergenic
1039210274 8:35205134-35205156 CATCTGCAGCAGCTGCTGCAAGG - Intergenic
1039892853 8:41696463-41696485 CACCCGCATCACCTGCCGCCTGG - Exonic
1040083858 8:43318509-43318531 CAGCAGCAGCACCATCAGTCAGG - Intergenic
1040277700 8:46022339-46022361 ATTCAGCATCACCTTCAGCCTGG + Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1041098696 8:54374735-54374757 CATCAGCAGCATCTCCTGCCTGG - Intergenic
1041861906 8:62523875-62523897 CAGTAGCACTACCTGCAGCCAGG + Intronic
1041943404 8:63414114-63414136 TATCTGCAGCAACTGCAGCATGG + Intergenic
1042051395 8:64712322-64712344 CAGCAGCAGCACTTGCATTCTGG + Intronic
1042271538 8:66961487-66961509 CAGCAGCAGCACGTCCAGCTTGG + Exonic
1043356752 8:79422820-79422842 CATCAGCAGCACCTGAGGGCTGG + Intergenic
1045418104 8:101986923-101986945 CATCAGCAGCACCTCCCTGCTGG - Intronic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046187152 8:110735333-110735355 CATCTGGAGCACCTGCTGCAGGG - Intergenic
1046543034 8:115611248-115611270 AACCAGCAGCACCTGCAGGTTGG - Intronic
1046819950 8:118622850-118622872 CATCCCCAGCACCTACAGCTAGG - Intergenic
1047381891 8:124372131-124372153 CCTCAGCAGCGGCAGCAGCCGGG + Exonic
1047608752 8:126500140-126500162 GATCAGAAGCACATGCAGGCTGG + Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048329702 8:133463446-133463468 CAACTGCAGCACCTACATCCCGG - Exonic
1048363746 8:133720292-133720314 CATGGGCAGCACCTGCAGCGGGG - Intergenic
1048649244 8:136455905-136455927 CATCAGCACCACCTGGACCATGG + Intergenic
1048735258 8:137492516-137492538 CACCTGCAGAACCTGCAGTCAGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049032937 8:140050629-140050651 CATCCCCAGCACCTCCACCCGGG + Intronic
1049639331 8:143707558-143707580 CAGCTGCAGCACCTGCGGCGGGG + Exonic
1049649615 8:143759426-143759448 CCTCAGCAGCACCTTCAGGCAGG - Intergenic
1049753559 8:144297294-144297316 CAGCAGCAGCCCTTGCTGCCAGG - Intronic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050591473 9:7164607-7164629 AAACAGGAGCACCTGCAGCACGG - Intergenic
1051874443 9:21776573-21776595 GATAAACAGCTCCTGCAGCCTGG - Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1053149782 9:35736111-35736133 CAGCAGCAGCACCTGCATCTTGG + Exonic
1056458752 9:86788921-86788943 CAGAAGCAGCAGCTGCACCCAGG + Intergenic
1056558113 9:87706613-87706635 GACCAGCAGCACCAGCAGCTCGG - Exonic
1056687425 9:88778122-88778144 CACCAGCTGGGCCTGCAGCCTGG - Intergenic
1058823680 9:108755618-108755640 CAGCAGCATCACCTGGAGGCTGG + Intergenic
1058912534 9:109534180-109534202 CATCAGCAGCACCTGCCGGCGGG - Intergenic
1059119772 9:111631481-111631503 CAGCAGCAGCGCCGGCAGCAGGG - Exonic
1059323801 9:113489755-113489777 CAGAAGGAGCACTTGCAGCCAGG - Intronic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1059602015 9:115789006-115789028 CACCTGCAGCACCTACTGCCTGG + Intergenic
1060247754 9:121960543-121960565 CAGCAGAAGCACCAACAGCCAGG - Intronic
1060516659 9:124270226-124270248 CATCCTCAGCACCTGGAGCGGGG + Intronic
1060781637 9:126417408-126417430 AATCAGCAGCAGCAGCAACCAGG - Intronic
1060968928 9:127727046-127727068 CATCTGCTCCAGCTGCAGCCTGG - Exonic
1060999546 9:127895437-127895459 CACCTGCAGCACCTGGAGGCTGG + Intronic
1061026258 9:128051739-128051761 CATCAAGATCACCTGAAGCCAGG + Intergenic
1061289163 9:129641118-129641140 CCCCGGCAACACCTGCAGCCAGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062127102 9:134869800-134869822 CATCAGGAGCACCTGAGGGCAGG - Intergenic
1062208350 9:135349410-135349432 GAACAGCAGCAGCCGCAGCCCGG - Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062713147 9:137987614-137987636 GATCAGCAGCCCCAGGAGCCAGG - Intronic
1185533305 X:839097-839119 CTTCAGCAGGATCTGCACCCTGG - Intergenic
1185533381 X:839437-839459 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533420 X:839607-839629 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533495 X:839947-839969 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533533 X:840117-840139 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533572 X:840287-840309 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187050614 X:15692094-15692116 CAAGAGCATCACCTGAAGCCAGG - Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187372667 X:18723578-18723600 CATCCGCAGCACCTGGGGCAAGG - Intronic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1190222806 X:48523176-48523198 CAGGAGCAGCACCTGAGGCCAGG - Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190522994 X:51299031-51299053 AATCAGCAGCAGCAGCACCCAGG + Intergenic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1193278336 X:79618200-79618222 TTTCAGCAGCATCTGCAGCAGGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1194583437 X:95704798-95704820 CACCCCCAGCACCTTCAGCCTGG + Intergenic
1195865852 X:109432057-109432079 CATCAGCATCACCTGGAAACCGG + Intronic
1195923846 X:110005928-110005950 CATCAGCCGCAGCTCCAGTCAGG - Intronic
1196018505 X:110964946-110964968 CACAAGCAGCAGCTGCTGCCTGG - Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1197235413 X:124056987-124057009 CATGAGAAGCACCTGAACCCAGG - Intronic
1197831257 X:130645812-130645834 CCTCAGCACCACCTCCAGGCAGG + Intronic
1198206429 X:134469583-134469605 GATCTGCAGAACCTGTAGCCAGG + Intronic
1198242083 X:134796806-134796828 CAGCCGCAGCATCTGTAGCCCGG - Intronic
1199024506 X:142920624-142920646 CATCAGCAGTGGCTGTAGCCAGG - Intergenic
1199927572 X:152484125-152484147 CATTAGCAGCACCTGAAAACTGG + Intergenic
1200550277 Y:4570884-4570906 CATGAGCACCACGCGCAGCCCGG - Intergenic
1200850502 Y:7878377-7878399 CATTAGAGGCACCTGCAACCAGG - Intergenic
1201798689 Y:17928885-17928907 CATCAACACCAGCTACAGCCAGG + Intergenic
1201802864 Y:17977072-17977094 CATCAACACCAGCTACAGCCAGG - Intergenic