ID: 1151980848

View in Genome Browser
Species Human (GRCh38)
Location 17:77507539-77507561
Sequence TCCCTCCAGGGACACGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151980848_1151980855 24 Left 1151980848 17:77507539-77507561 CCATCACCGTGTCCCTGGAGGGA No data
Right 1151980855 17:77507586-77507608 CTTCTGCAAGAAGAATCACCAGG No data
1151980848_1151980856 29 Left 1151980848 17:77507539-77507561 CCATCACCGTGTCCCTGGAGGGA No data
Right 1151980856 17:77507591-77507613 GCAAGAAGAATCACCAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151980848 Original CRISPR TCCCTCCAGGGACACGGTGA TGG (reversed) Intergenic
No off target data available for this crispr