ID: 1151984582

View in Genome Browser
Species Human (GRCh38)
Location 17:77534096-77534118
Sequence CAGGGTATACACACAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151984582_1151984588 2 Left 1151984582 17:77534096-77534118 CCATCCACTGTGTGTATACCCTG No data
Right 1151984588 17:77534121-77534143 CTTCCTGGCCCTCCATGCTTGGG No data
1151984582_1151984590 7 Left 1151984582 17:77534096-77534118 CCATCCACTGTGTGTATACCCTG No data
Right 1151984590 17:77534126-77534148 TGGCCCTCCATGCTTGGGCATGG No data
1151984582_1151984595 25 Left 1151984582 17:77534096-77534118 CCATCCACTGTGTGTATACCCTG No data
Right 1151984595 17:77534144-77534166 CATGGACGTGTGATATGGTTTGG No data
1151984582_1151984594 20 Left 1151984582 17:77534096-77534118 CCATCCACTGTGTGTATACCCTG No data
Right 1151984594 17:77534139-77534161 TTGGGCATGGACGTGTGATATGG No data
1151984582_1151984587 1 Left 1151984582 17:77534096-77534118 CCATCCACTGTGTGTATACCCTG No data
Right 1151984587 17:77534120-77534142 ACTTCCTGGCCCTCCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151984582 Original CRISPR CAGGGTATACACACAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr