ID: 1151987366

View in Genome Browser
Species Human (GRCh38)
Location 17:77552615-77552637
Sequence AGAACTCAGTTCTCTACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151987364_1151987366 -6 Left 1151987364 17:77552598-77552620 CCTACCAGTGAATAAAGAGAACT No data
Right 1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG No data
1151987362_1151987366 29 Left 1151987362 17:77552563-77552585 CCTCTTGGATGGGATGTGGCCAG No data
Right 1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG No data
1151987363_1151987366 10 Left 1151987363 17:77552582-77552604 CCAGAGAACACAGAAACCTACCA No data
Right 1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG No data
1151987365_1151987366 -10 Left 1151987365 17:77552602-77552624 CCAGTGAATAAAGAGAACTCAGT No data
Right 1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151987366 Original CRISPR AGAACTCAGTTCTCTACCCT TGG Intergenic
No off target data available for this crispr