ID: 1151990264

View in Genome Browser
Species Human (GRCh38)
Location 17:77570158-77570180
Sequence TCCCTGGCTACCTCCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990264_1151990273 13 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990273 17:77570194-77570216 TGGTTCCACAGTGGCGTCCATGG No data
1151990264_1151990277 22 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990277 17:77570203-77570225 AGTGGCGTCCATGGAGGAAAGGG No data
1151990264_1151990271 4 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990271 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
1151990264_1151990276 21 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990264_1151990268 -7 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990268 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
1151990264_1151990274 16 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990274 17:77570197-77570219 TTCCACAGTGGCGTCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990264 Original CRISPR TCCCTGGCTACCTCCATGGC AGG (reversed) Intergenic
No off target data available for this crispr