ID: 1151990267

View in Genome Browser
Species Human (GRCh38)
Location 17:77570174-77570196
Sequence CCAGCCTAAGGGGCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990267_1151990283 29 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990283 17:77570226-77570248 TGAAACTCTCGGTGGTGCTGGGG No data
1151990267_1151990282 28 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990282 17:77570225-77570247 GTGAAACTCTCGGTGGTGCTGGG No data
1151990267_1151990281 27 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990267_1151990274 0 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990274 17:77570197-77570219 TTCCACAGTGGCGTCCATGGAGG No data
1151990267_1151990276 5 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990267_1151990279 18 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990267_1151990277 6 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990277 17:77570203-77570225 AGTGGCGTCCATGGAGGAAAGGG No data
1151990267_1151990280 21 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990267_1151990273 -3 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990273 17:77570194-77570216 TGGTTCCACAGTGGCGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990267 Original CRISPR CCAGCCTAAGGGGCTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr