ID: 1151990270

View in Genome Browser
Species Human (GRCh38)
Location 17:77570185-77570207
Sequence CCACTGTGGAACCAGCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990270_1151990280 10 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990270_1151990283 18 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990283 17:77570226-77570248 TGAAACTCTCGGTGGTGCTGGGG No data
1151990270_1151990279 7 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990270_1151990277 -5 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990277 17:77570203-77570225 AGTGGCGTCCATGGAGGAAAGGG No data
1151990270_1151990276 -6 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990270_1151990284 25 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990284 17:77570233-77570255 CTCGGTGGTGCTGGGGTCCCAGG No data
1151990270_1151990281 16 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990270_1151990282 17 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990282 17:77570225-77570247 GTGAAACTCTCGGTGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990270 Original CRISPR CCACTGTGGAACCAGCCTAA GGG (reversed) Intergenic
No off target data available for this crispr