ID: 1151990275

View in Genome Browser
Species Human (GRCh38)
Location 17:77570199-77570221
Sequence TTCCTCCATGGACGCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990275_1151990282 3 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990282 17:77570225-77570247 GTGAAACTCTCGGTGGTGCTGGG No data
1151990275_1151990285 19 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990285 17:77570241-77570263 TGCTGGGGTCCCAGGCAGCACGG No data
1151990275_1151990279 -7 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990275_1151990289 30 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990289 17:77570252-77570274 CAGGCAGCACGGGACCTTCGTGG No data
1151990275_1151990284 11 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990284 17:77570233-77570255 CTCGGTGGTGCTGGGGTCCCAGG No data
1151990275_1151990286 20 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990286 17:77570242-77570264 GCTGGGGTCCCAGGCAGCACGGG No data
1151990275_1151990283 4 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990283 17:77570226-77570248 TGAAACTCTCGGTGGTGCTGGGG No data
1151990275_1151990281 2 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990275_1151990280 -4 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990275 Original CRISPR TTCCTCCATGGACGCCACTG TGG (reversed) Intergenic
No off target data available for this crispr