ID: 1151990276

View in Genome Browser
Species Human (GRCh38)
Location 17:77570202-77570224
Sequence CAGTGGCGTCCATGGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990269_1151990276 -5 Left 1151990269 17:77570184-77570206 CCCCTTAGGCTGGTTCCACAGTG No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990264_1151990276 21 Left 1151990264 17:77570158-77570180 CCTGCCATGGAGGTAGCCAGGGA No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990265_1151990276 17 Left 1151990265 17:77570162-77570184 CCATGGAGGTAGCCAGGGACAGC No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990267_1151990276 5 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990270_1151990276 -6 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data
1151990272_1151990276 -7 Left 1151990272 17:77570186-77570208 CCTTAGGCTGGTTCCACAGTGGC No data
Right 1151990276 17:77570202-77570224 CAGTGGCGTCCATGGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990276 Original CRISPR CAGTGGCGTCCATGGAGGAA AGG Intergenic
No off target data available for this crispr