ID: 1151990278

View in Genome Browser
Species Human (GRCh38)
Location 17:77570211-77570233
Sequence GAGTTTCACCCTTTCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990278_1151990286 8 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990286 17:77570242-77570264 GCTGGGGTCCCAGGCAGCACGGG No data
1151990278_1151990290 22 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990290 17:77570256-77570278 CAGCACGGGACCTTCGTGGATGG No data
1151990278_1151990281 -10 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990278_1151990283 -8 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990283 17:77570226-77570248 TGAAACTCTCGGTGGTGCTGGGG No data
1151990278_1151990285 7 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990285 17:77570241-77570263 TGCTGGGGTCCCAGGCAGCACGG No data
1151990278_1151990284 -1 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990284 17:77570233-77570255 CTCGGTGGTGCTGGGGTCCCAGG No data
1151990278_1151990291 23 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990291 17:77570257-77570279 AGCACGGGACCTTCGTGGATGGG No data
1151990278_1151990293 30 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990293 17:77570264-77570286 GACCTTCGTGGATGGGATGGCGG No data
1151990278_1151990289 18 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990289 17:77570252-77570274 CAGGCAGCACGGGACCTTCGTGG No data
1151990278_1151990282 -9 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990282 17:77570225-77570247 GTGAAACTCTCGGTGGTGCTGGG No data
1151990278_1151990292 27 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990292 17:77570261-77570283 CGGGACCTTCGTGGATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990278 Original CRISPR GAGTTTCACCCTTTCCTCCA TGG (reversed) Intergenic
No off target data available for this crispr