ID: 1151990279

View in Genome Browser
Species Human (GRCh38)
Location 17:77570215-77570237
Sequence GGAGGAAAGGGTGAAACTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990269_1151990279 8 Left 1151990269 17:77570184-77570206 CCCCTTAGGCTGGTTCCACAGTG No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990265_1151990279 30 Left 1151990265 17:77570162-77570184 CCATGGAGGTAGCCAGGGACAGC No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990267_1151990279 18 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990272_1151990279 6 Left 1151990272 17:77570186-77570208 CCTTAGGCTGGTTCCACAGTGGC No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990270_1151990279 7 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data
1151990275_1151990279 -7 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990279 17:77570215-77570237 GGAGGAAAGGGTGAAACTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990279 Original CRISPR GGAGGAAAGGGTGAAACTCT CGG Intergenic
No off target data available for this crispr