ID: 1151990280

View in Genome Browser
Species Human (GRCh38)
Location 17:77570218-77570240
Sequence GGAAAGGGTGAAACTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990267_1151990280 21 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990270_1151990280 10 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990269_1151990280 11 Left 1151990269 17:77570184-77570206 CCCCTTAGGCTGGTTCCACAGTG No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990275_1151990280 -4 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data
1151990272_1151990280 9 Left 1151990272 17:77570186-77570208 CCTTAGGCTGGTTCCACAGTGGC No data
Right 1151990280 17:77570218-77570240 GGAAAGGGTGAAACTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990280 Original CRISPR GGAAAGGGTGAAACTCTCGG TGG Intergenic
No off target data available for this crispr