ID: 1151990281

View in Genome Browser
Species Human (GRCh38)
Location 17:77570224-77570246
Sequence GGTGAAACTCTCGGTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151990278_1151990281 -10 Left 1151990278 17:77570211-77570233 CCATGGAGGAAAGGGTGAAACTC No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990267_1151990281 27 Left 1151990267 17:77570174-77570196 CCAGGGACAGCCCCTTAGGCTGG No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990275_1151990281 2 Left 1151990275 17:77570199-77570221 CCACAGTGGCGTCCATGGAGGAA No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990270_1151990281 16 Left 1151990270 17:77570185-77570207 CCCTTAGGCTGGTTCCACAGTGG No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990272_1151990281 15 Left 1151990272 17:77570186-77570208 CCTTAGGCTGGTTCCACAGTGGC No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data
1151990269_1151990281 17 Left 1151990269 17:77570184-77570206 CCCCTTAGGCTGGTTCCACAGTG No data
Right 1151990281 17:77570224-77570246 GGTGAAACTCTCGGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151990281 Original CRISPR GGTGAAACTCTCGGTGGTGC TGG Intergenic
No off target data available for this crispr