ID: 1151991354

View in Genome Browser
Species Human (GRCh38)
Location 17:77576891-77576913
Sequence GTCCATGTGAAGGAAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151991354_1151991360 13 Left 1151991354 17:77576891-77576913 CCCACAGTTTCCTTCACATGGAC No data
Right 1151991360 17:77576927-77576949 GTAGCAGCTCACACCGGGTGAGG No data
1151991354_1151991358 7 Left 1151991354 17:77576891-77576913 CCCACAGTTTCCTTCACATGGAC No data
Right 1151991358 17:77576921-77576943 TTAAGAGTAGCAGCTCACACCGG No data
1151991354_1151991361 16 Left 1151991354 17:77576891-77576913 CCCACAGTTTCCTTCACATGGAC No data
Right 1151991361 17:77576930-77576952 GCAGCTCACACCGGGTGAGGTGG No data
1151991354_1151991359 8 Left 1151991354 17:77576891-77576913 CCCACAGTTTCCTTCACATGGAC No data
Right 1151991359 17:77576922-77576944 TAAGAGTAGCAGCTCACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151991354 Original CRISPR GTCCATGTGAAGGAAACTGT GGG (reversed) Intergenic
No off target data available for this crispr