ID: 1151996245

View in Genome Browser
Species Human (GRCh38)
Location 17:77611102-77611124
Sequence GCTCCCTTCTCGGTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151996245_1151996250 -7 Left 1151996245 17:77611102-77611124 CCTCCCTCCACCGAGAAGGGAGC No data
Right 1151996250 17:77611118-77611140 AGGGAGCTTCCAGTGTGTTAAGG No data
1151996245_1151996251 -6 Left 1151996245 17:77611102-77611124 CCTCCCTCCACCGAGAAGGGAGC No data
Right 1151996251 17:77611119-77611141 GGGAGCTTCCAGTGTGTTAAGGG No data
1151996245_1151996252 -5 Left 1151996245 17:77611102-77611124 CCTCCCTCCACCGAGAAGGGAGC No data
Right 1151996252 17:77611120-77611142 GGAGCTTCCAGTGTGTTAAGGGG No data
1151996245_1151996253 -4 Left 1151996245 17:77611102-77611124 CCTCCCTCCACCGAGAAGGGAGC No data
Right 1151996253 17:77611121-77611143 GAGCTTCCAGTGTGTTAAGGGGG No data
1151996245_1151996254 -3 Left 1151996245 17:77611102-77611124 CCTCCCTCCACCGAGAAGGGAGC No data
Right 1151996254 17:77611122-77611144 AGCTTCCAGTGTGTTAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151996245 Original CRISPR GCTCCCTTCTCGGTGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr