ID: 1151998392

View in Genome Browser
Species Human (GRCh38)
Location 17:77628081-77628103
Sequence TTCTCCCCATTCCAAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151998389_1151998392 -3 Left 1151998389 17:77628061-77628083 CCAGAAGCCTGCCTTGAACTTTC No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998386_1151998392 5 Left 1151998386 17:77628053-77628075 CCCTCTTCCCAGAAGCCTGCCTT No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998383_1151998392 23 Left 1151998383 17:77628035-77628057 CCTCTCCACTCAGATGTCCCCTC No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998388_1151998392 -2 Left 1151998388 17:77628060-77628082 CCCAGAAGCCTGCCTTGAACTTT No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998384_1151998392 18 Left 1151998384 17:77628040-77628062 CCACTCAGATGTCCCCTCTTCCC No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998385_1151998392 6 Left 1151998385 17:77628052-77628074 CCCCTCTTCCCAGAAGCCTGCCT No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998387_1151998392 4 Left 1151998387 17:77628054-77628076 CCTCTTCCCAGAAGCCTGCCTTG No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data
1151998390_1151998392 -10 Left 1151998390 17:77628068-77628090 CCTGCCTTGAACTTTCTCCCCAT No data
Right 1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151998392 Original CRISPR TTCTCCCCATTCCAAAGAGA TGG Intergenic
No off target data available for this crispr