ID: 1151999217

View in Genome Browser
Species Human (GRCh38)
Location 17:77634872-77634894
Sequence CACTCCCTCTCGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151999213_1151999217 -6 Left 1151999213 17:77634855-77634877 CCGTGTCTGCAGGGCCACACTCC No data
Right 1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG No data
1151999210_1151999217 11 Left 1151999210 17:77634838-77634860 CCAGGAGTCTGAAATCACCGTGT No data
Right 1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151999217 Original CRISPR CACTCCCTCTCGAGGCTCTA GGG Intergenic
No off target data available for this crispr