ID: 1152001442

View in Genome Browser
Species Human (GRCh38)
Location 17:77647929-77647951
Sequence ATCGATTTTAGGCCTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152001442_1152001448 27 Left 1152001442 17:77647929-77647951 CCATGGTCAGGCCTAAAATCGAT No data
Right 1152001448 17:77647979-77648001 GTTGGCCTTACCTGTATGCAGGG No data
1152001442_1152001445 9 Left 1152001442 17:77647929-77647951 CCATGGTCAGGCCTAAAATCGAT No data
Right 1152001445 17:77647961-77647983 AATCTCCTGCAGGACTGCGTTGG No data
1152001442_1152001447 26 Left 1152001442 17:77647929-77647951 CCATGGTCAGGCCTAAAATCGAT No data
Right 1152001447 17:77647978-77648000 CGTTGGCCTTACCTGTATGCAGG No data
1152001442_1152001444 -1 Left 1152001442 17:77647929-77647951 CCATGGTCAGGCCTAAAATCGAT No data
Right 1152001444 17:77647951-77647973 TGAGATTAAGAATCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152001442 Original CRISPR ATCGATTTTAGGCCTGACCA TGG (reversed) Intergenic
No off target data available for this crispr