ID: 1152001696

View in Genome Browser
Species Human (GRCh38)
Location 17:77649931-77649953
Sequence TTTGGCCAAACGACGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152001684_1152001696 18 Left 1152001684 17:77649890-77649912 CCATAGAAACTCTGGTCCCCTGG No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001690_1152001696 0 Left 1152001690 17:77649908-77649930 CCTGGCGGGTCCAGCCCATAGAC No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001692_1152001696 -10 Left 1152001692 17:77649918-77649940 CCAGCCCATAGACTTTGGCCAAA No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001688_1152001696 2 Left 1152001688 17:77649906-77649928 CCCCTGGCGGGTCCAGCCCATAG No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001683_1152001696 19 Left 1152001683 17:77649889-77649911 CCCATAGAAACTCTGGTCCCCTG No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001682_1152001696 20 Left 1152001682 17:77649888-77649910 CCCCATAGAAACTCTGGTCCCCT No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data
1152001689_1152001696 1 Left 1152001689 17:77649907-77649929 CCCTGGCGGGTCCAGCCCATAGA No data
Right 1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152001696 Original CRISPR TTTGGCCAAACGACGGATGA AGG Intergenic