ID: 1152001951

View in Genome Browser
Species Human (GRCh38)
Location 17:77652096-77652118
Sequence CCTCCTCGAAGGTCACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152001943_1152001951 12 Left 1152001943 17:77652061-77652083 CCACTGGTGATTGACTCAATCTC No data
Right 1152001951 17:77652096-77652118 CCTCCTCGAAGGTCACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152001951 Original CRISPR CCTCCTCGAAGGTCACTGGG TGG Intergenic
No off target data available for this crispr