ID: 1152003921

View in Genome Browser
Species Human (GRCh38)
Location 17:77665312-77665334
Sequence CAATTATGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152003921_1152003926 -1 Left 1152003921 17:77665312-77665334 CCTTCCACCTTCTGCCATAATTG No data
Right 1152003926 17:77665334-77665356 GTGAGGCCTCCGCAGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152003921 Original CRISPR CAATTATGGCAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr