ID: 1152007564

View in Genome Browser
Species Human (GRCh38)
Location 17:77691995-77692017
Sequence CACTGTGACGGGGGTAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152007564_1152007578 18 Left 1152007564 17:77691995-77692017 CCGTCCCTACCCCCGTCACAGTG No data
Right 1152007578 17:77692036-77692058 CTTAGCAATTGTCAAAGAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152007564 Original CRISPR CACTGTGACGGGGGTAGGGA CGG (reversed) Intergenic
No off target data available for this crispr