ID: 1152009162

View in Genome Browser
Species Human (GRCh38)
Location 17:77700326-77700348
Sequence AGGGCACTGACAGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152009153_1152009162 15 Left 1152009153 17:77700288-77700310 CCTCCCTGGGAGAGTGAAGTAGC No data
Right 1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG No data
1152009156_1152009162 11 Left 1152009156 17:77700292-77700314 CCTGGGAGAGTGAAGTAGCGGCT No data
Right 1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG No data
1152009155_1152009162 12 Left 1152009155 17:77700291-77700313 CCCTGGGAGAGTGAAGTAGCGGC No data
Right 1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG No data
1152009152_1152009162 24 Left 1152009152 17:77700279-77700301 CCTCAGTGGCCTCCCTGGGAGAG No data
Right 1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152009162 Original CRISPR AGGGCACTGACAGGTCTTCC TGG Intergenic
No off target data available for this crispr