ID: 1152011827

View in Genome Browser
Species Human (GRCh38)
Location 17:77723720-77723742
Sequence TGCTGAACACCCTTCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152011827 Original CRISPR TGCTGAACACCCTTCAGTGC TGG Intergenic
900542141 1:3208315-3208337 CACTAAACACCCTACAGTGCAGG - Intronic
901575128 1:10194567-10194589 GGCTGCAAACCCATCAGTGCAGG - Intergenic
902051816 1:13569117-13569139 GGAGGAACACCCTTCAGGGCGGG + Intergenic
902706750 1:18210689-18210711 TGCTAAACACCCTGCAGTGCGGG - Intronic
905883454 1:41479165-41479187 TGCGGAGCAGCCTCCAGTGCTGG - Exonic
910443329 1:87275216-87275238 TGGAGAAAACCCTCCAGTGCTGG - Intergenic
910487582 1:87732587-87732609 TGCTAAACACCCCTCAATGCAGG + Intergenic
912734228 1:112135799-112135821 TGCTTAAAACCCTTCTGTGGTGG - Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
923644868 1:235808992-235809014 TGCTGAAAATTTTTCAGTGCTGG + Exonic
1063859906 10:10295760-10295782 TGCTGGACAGCCTGAAGTGCAGG - Intergenic
1064021709 10:11814385-11814407 AAATGAACACCCTTCAGTTCAGG + Intergenic
1066153609 10:32651076-32651098 AGCTGAGGACCCTTGAGTGCAGG - Intronic
1069186282 10:65427694-65427716 TGCTGAAAACCATGCAATGCAGG + Intergenic
1069266542 10:66465505-66465527 TGAAAAACACGCTTCAGTGCAGG - Intronic
1072036497 10:91567667-91567689 TGTGTAACACCCTTCAGTGATGG + Intergenic
1075296502 10:121281098-121281120 TGCTGAAGCTCCTTCAGGGCTGG - Intergenic
1076266640 10:129113959-129113981 TGCTGACCACCCCCCATTGCTGG + Intergenic
1077331912 11:1987586-1987608 GTCTGACCACCCTTCAATGCTGG + Intergenic
1079374656 11:19881211-19881233 TGCATTACACCCATCAGTGCTGG - Intronic
1079425012 11:20332035-20332057 TGCTGGACACTCTTAACTGCAGG + Intergenic
1083935097 11:65865861-65865883 TGCTGAGCACCATTAAGTGTGGG + Exonic
1084945055 11:72633920-72633942 TGCTGTGCTCCCTTCAGCGCTGG - Intronic
1089378135 11:118009442-118009464 TGCTGAGCACATATCAGTGCAGG - Intergenic
1202814893 11_KI270721v1_random:42762-42784 GTCTGACCACCCTTCAATGCTGG + Intergenic
1097458467 12:59831418-59831440 GGCTGAACACCCTTGAATACAGG - Intergenic
1103504919 12:121435905-121435927 TTCTGATCACCCTTGAGTGGAGG + Intronic
1107443860 13:40452559-40452581 TGCTGGTCAGTCTTCAGTGCAGG - Intergenic
1107958209 13:45537970-45537992 TGCTGAACATCCTACAGCACTGG + Intronic
1109649909 13:65311109-65311131 TGATGCACAGCCTTCAGTGGGGG - Intergenic
1111404102 13:87779479-87779501 TGCTGAACAGCCATCAGAGTGGG - Intergenic
1112193810 13:97204733-97204755 TCTGGAACTCCCTTCAGTGCTGG + Intergenic
1113401126 13:109994282-109994304 TGGGGGACACCCTTCATTGCAGG - Intergenic
1115394661 14:32894560-32894582 TGCTCACCACCCTTCCCTGCAGG + Intergenic
1116891907 14:50276913-50276935 TGCTAAACATCCTTCAGTGTGGG - Intronic
1118059946 14:62125131-62125153 TGCTGAAAAGCCTTCACAGCTGG - Intergenic
1120795325 14:88626001-88626023 TCCTGAACACCCTTCTGTCAGGG + Exonic
1122037402 14:98958664-98958686 CCCTGAACACCCTTCAGCCCCGG + Intergenic
1123938669 15:25206190-25206212 TGCTCACCACACCTCAGTGCAGG - Intergenic
1126159308 15:45595075-45595097 TGCTGAACACACTGATGTGCTGG - Intronic
1129343899 15:74904636-74904658 TCCAGAACACCTTTCTGTGCAGG - Intronic
1131220100 15:90576592-90576614 TCCTGACCATCCTTTAGTGCTGG - Intronic
1133046710 16:3092187-3092209 TGCGGAAGAGCCTTCAGTGCTGG - Exonic
1133091899 16:3411218-3411240 TACTGAACCGCCTGCAGTGCCGG + Intronic
1139524236 16:67503835-67503857 TGCTGAAGACTCTGCAGTGCTGG + Intergenic
1141687827 16:85580384-85580406 TGCTGGCCAGCCTTCAGGGCTGG - Intergenic
1142194461 16:88733064-88733086 TACTGGACACCCTTGTGTGCAGG + Intronic
1144768414 17:17745691-17745713 TGCTTAAAAGCCTTCAGGGCTGG - Intronic
1145265728 17:21378760-21378782 GGCTCCACCCCCTTCAGTGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148507564 17:48139988-48140010 ACTTGAACACCTTTCAGTGCTGG - Intronic
1148792619 17:50182085-50182107 TGCTCAACACCCTACTGTCCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152011827 17:77723720-77723742 TGCTGAACACCCTTCAGTGCTGG + Intergenic
1152918705 17:83054979-83055001 TTCTCAGCAGCCTTCAGTGCTGG + Intergenic
1154356744 18:13627423-13627445 CGCTGGGGACCCTTCAGTGCCGG + Intronic
1157199377 18:45646224-45646246 AACTGATGACCCTTCAGTGCTGG + Intronic
1158014326 18:52766151-52766173 TGCTGCACACCCTTCACAGGAGG + Intronic
1160986677 19:1842338-1842360 TGCTCAGCACCCTTCAGTGCTGG - Intronic
1166886214 19:45962503-45962525 TGCTTAACACCCTCCACTCCTGG + Intronic
1168049809 19:53820956-53820978 TGCTTAACACAATTCAGAGCAGG - Intronic
925907766 2:8549554-8549576 TCCTGGAGACCCTTCAGAGCTGG + Intergenic
926746531 2:16163094-16163116 TGCCCAACTCCCTTCAGTGATGG + Intergenic
926980685 2:18563964-18563986 TGCTGAAGACCCTTCGACGCTGG - Exonic
927289382 2:21390193-21390215 TGCAGAAAGTCCTTCAGTGCAGG - Intergenic
930346944 2:50195113-50195135 TGCTGACCAATCTTCAGTCCAGG - Intronic
930675674 2:54197849-54197871 TGCTTAAAACCCTCCAGTGTAGG - Intronic
931431129 2:62209774-62209796 TGCTGATCTCCCTTCACTGCAGG + Intronic
931561549 2:63567081-63567103 TGGTGAACACATTGCAGTGCTGG - Intronic
932856140 2:75235745-75235767 TGCTGGGAACCCTTCAGTCCTGG + Intergenic
935371536 2:102351990-102352012 TGCTCCTCACACTTCAGTGCAGG - Exonic
935520029 2:104093615-104093637 TTCTGTAGACCATTCAGTGCTGG + Intergenic
938894203 2:135734526-135734548 TGCTTAAAAATCTTCAGTGCCGG - Intergenic
940303431 2:152200293-152200315 TGCTGGACACTCTTCTGTCCAGG - Intergenic
946758175 2:222967057-222967079 TCCTGAACATCCTTCAAGGCTGG + Intergenic
948887526 2:240891622-240891644 TGCTGCACCCCCTCCAGGGCAGG + Exonic
949021428 2:241743217-241743239 TGCTCAACACCCAACAGTGCAGG - Intronic
1169332999 20:4731038-4731060 TGCAAAACACCCTTCCCTGCTGG - Intergenic
1169663266 20:8005193-8005215 TGCTCATCACCCTTGAGTGATGG - Intronic
1169911647 20:10652147-10652169 TCCTGAATACCCCTCAGGGCAGG + Exonic
1169916220 20:10686543-10686565 GGGTGGACACCCTTCACTGCAGG + Intergenic
1171150643 20:22823953-22823975 TGTTGAAGACACTTCGGTGCTGG + Intergenic
1173259216 20:41418551-41418573 TGCTTAAAACCTTTCAGTGGTGG - Intronic
1175764642 20:61583779-61583801 CGCTGTCCACACTTCAGTGCAGG - Intronic
1179471184 21:41611778-41611800 TTCTGAACAGCCTCCTGTGCTGG + Intergenic
1179799175 21:43802915-43802937 TGCTCAACCCCCTCCACTGCAGG - Intronic
1180841242 22:18959851-18959873 TGCTGCACTCCCTTCCCTGCCGG - Intergenic
1181643397 22:24216764-24216786 TGCTCAACATCCTACAGTGTGGG + Intergenic
1185159495 22:49214696-49214718 TTCTAAACACCCCACAGTGCAGG + Intergenic
950377865 3:12586542-12586564 TGTGGAACACCTTTCAGTGGTGG - Intronic
950651684 3:14411136-14411158 TGCTCAAAAGCCTTCAGTGGTGG + Intronic
951370562 3:21841283-21841305 ATCTGAACACCCATCAGTGCAGG - Intronic
953243230 3:41167861-41167883 TGCTGAAGACTCTTCAGGGGTGG - Intergenic
954287200 3:49627335-49627357 TGGTGAATACCCTTCTCTGCTGG + Intronic
958915747 3:100048170-100048192 TGCTGAACAGCCCTCAGGGAAGG + Intronic
964239962 3:154580802-154580824 TGCTGAACACACTGAAGTGCTGG + Intergenic
967900976 3:194452052-194452074 TGCTTAAAACCCTTCAATGGTGG + Intronic
968567271 4:1319806-1319828 TTCTGAAGCCCCTTCAGGGCAGG - Intronic
977963225 4:103109803-103109825 AGCTTAAAACCCTCCAGTGCAGG + Intronic
984244732 4:177261481-177261503 TGCAGAACACCATTTAGTCCAGG - Intergenic
985558940 5:571981-572003 TGCTGCACACCCCTGTGTGCAGG - Intergenic
986120300 5:4829315-4829337 TGCTGAACACCGCTCAGCACTGG - Intergenic
990444348 5:55880224-55880246 TGATGACCACCCTTTAGTCCAGG + Intronic
996867707 5:128145920-128145942 TGATGATCACCATTCACTGCTGG + Intronic
997865630 5:137460320-137460342 TGCTTAACAATCTTCACTGCAGG + Intronic
998657844 5:144202170-144202192 TGCTGTTCAGCCTTCAGTCCGGG + Intronic
999293798 5:150445271-150445293 TGCTGAACATCCTACAATGCAGG + Intronic
1002181053 5:177431349-177431371 TGCTGGGCACCCCTCAGGGCTGG - Intronic
1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG + Intergenic
1003243036 6:4361155-4361177 TGCCCAACAGCCTTCAGTGGTGG + Intergenic
1006984863 6:38169523-38169545 GGCTGAGCAGCCTTCAGGGCAGG - Exonic
1012802668 6:103851933-103851955 AGCTGAAGACCCTGCAATGCTGG - Intergenic
1013901928 6:115167253-115167275 TGTAGAACAGCCTGCAGTGCTGG - Intergenic
1017172416 6:151470453-151470475 TGCTGAACTACTTCCAGTGCTGG - Intergenic
1019537989 7:1538790-1538812 TGCTGGTCACCCCACAGTGCCGG + Intronic
1019707670 7:2504271-2504293 TGCACAACACCCTTCAAAGCGGG + Intergenic
1021225927 7:18026308-18026330 TGCTGAACACCCTCAACAGCAGG - Intergenic
1025908464 7:65808450-65808472 TGCTGAGCACCGTGCAGGGCAGG - Intergenic
1028403030 7:90445462-90445484 TTCTGACCACCTATCAGTGCTGG + Intronic
1030015196 7:105212294-105212316 GACTGTACACCCCTCAGTGCTGG - Intronic
1032698932 7:134361823-134361845 TGCTAAACATCTTACAGTGCAGG - Intergenic
1035274809 7:157741413-157741435 TGCCGAAGAGCCTTCAGTGGGGG - Intronic
1037324716 8:17676991-17677013 TGCTGACCACGTTTCAGTGCTGG - Intronic
1043354451 8:79395873-79395895 TGCTCAACACTCTACAATGCAGG - Intergenic
1044348427 8:91134242-91134264 AGCTGAAGACCCTGGAGTGCTGG + Intronic
1048526767 8:135210017-135210039 TGCTGAACACCATGCTGGGCAGG - Intergenic
1051668521 9:19487752-19487774 CGCTGAACAGCCCTAAGTGCAGG - Intergenic
1054782310 9:69176349-69176371 TGCTGAAAACTCTTAAGTGTTGG + Intronic
1057408897 9:94799039-94799061 TGGTGAAATGCCTTCAGTGCTGG + Intronic
1059154675 9:111979273-111979295 AGCTTAACTCTCTTCAGTGCTGG + Intergenic
1059748156 9:117222778-117222800 TGCTGAAGATCCTTAAGTGAGGG - Intronic
1061477339 9:130877014-130877036 TTCTTAATACCCTTCAGTGGTGG + Intronic
1061500495 9:130998767-130998789 TCCTGAACACCGCTCAGTGCAGG + Intergenic
1061552954 9:131348662-131348684 TGCTGAACTCCCATCTGGGCTGG + Intergenic
1188784801 X:34332554-34332576 TGCTAAACATCCTACACTGCAGG + Intergenic
1188913778 X:35884237-35884259 TGCTATAAACACTTCAGTGCAGG + Intergenic
1196745697 X:119070181-119070203 TGATGAACAAACTTCAGTGTAGG + Intergenic
1198622259 X:138526387-138526409 TTCTGAAGACCCTTAAGTCCTGG - Intergenic