ID: 1152012219

View in Genome Browser
Species Human (GRCh38)
Location 17:77725612-77725634
Sequence CTGAAGTAGGAGAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152012213_1152012219 24 Left 1152012213 17:77725565-77725587 CCGGGGGTCTGTGAGGCTCTTGA No data
Right 1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152012219 Original CRISPR CTGAAGTAGGAGAAGGAGGT TGG Intergenic
No off target data available for this crispr