ID: 1152012566

View in Genome Browser
Species Human (GRCh38)
Location 17:77727373-77727395
Sequence CTGAGGGGCTTGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152012566_1152012579 14 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012579 17:77727410-77727432 GGGCCTGCCTCCACCTTGGCTGG No data
1152012566_1152012578 10 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012578 17:77727406-77727428 CCAAGGGCCTGCCTCCACCTTGG No data
1152012566_1152012581 16 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012581 17:77727412-77727434 GCCTGCCTCCACCTTGGCTGGGG No data
1152012566_1152012586 21 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012586 17:77727417-77727439 CCTCCACCTTGGCTGGGGGAGGG No data
1152012566_1152012569 -7 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012569 17:77727389-77727411 CCCTCAGTCCCCCTCACCCAAGG No data
1152012566_1152012589 26 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012589 17:77727422-77727444 ACCTTGGCTGGGGGAGGGCAGGG No data
1152012566_1152012588 25 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012588 17:77727421-77727443 CACCTTGGCTGGGGGAGGGCAGG No data
1152012566_1152012580 15 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012580 17:77727411-77727433 GGCCTGCCTCCACCTTGGCTGGG No data
1152012566_1152012583 17 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012583 17:77727413-77727435 CCTGCCTCCACCTTGGCTGGGGG No data
1152012566_1152012584 20 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012584 17:77727416-77727438 GCCTCCACCTTGGCTGGGGGAGG No data
1152012566_1152012591 29 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012591 17:77727425-77727447 TTGGCTGGGGGAGGGCAGGGAGG No data
1152012566_1152012571 -6 Left 1152012566 17:77727373-77727395 CCATCATCACTCAAGCCCCTCAG No data
Right 1152012571 17:77727390-77727412 CCTCAGTCCCCCTCACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152012566 Original CRISPR CTGAGGGGCTTGAGTGATGA TGG (reversed) Intergenic
No off target data available for this crispr