ID: 1152014530

View in Genome Browser
Species Human (GRCh38)
Location 17:77741787-77741809
Sequence CAGCCCTGAGACCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152014525_1152014530 -1 Left 1152014525 17:77741765-77741787 CCTTGTGCAGGGCCCACATCTCC No data
Right 1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG No data
1152014523_1152014530 10 Left 1152014523 17:77741754-77741776 CCAGGCTCACGCCTTGTGCAGGG No data
Right 1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152014530 Original CRISPR CAGCCCTGAGACCCTGCCCT GGG Intergenic
No off target data available for this crispr