ID: 1152014994

View in Genome Browser
Species Human (GRCh38)
Location 17:77744696-77744718
Sequence GGCCAGGACCATAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152014994_1152015000 -1 Left 1152014994 17:77744696-77744718 CCCTGCCCACTATGGTCCTGGCC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152014994 Original CRISPR GGCCAGGACCATAGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr