ID: 1152015000

View in Genome Browser
Species Human (GRCh38)
Location 17:77744718-77744740
Sequence CTCACCACTCACTGCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152014990_1152015000 20 Left 1152014990 17:77744675-77744697 CCATGGAGATGCTCAGGCCTTCC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014987_1152015000 29 Left 1152014987 17:77744666-77744688 CCAATGTGCCCATGGAGATGCTC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014992_1152015000 3 Left 1152014992 17:77744692-77744714 CCTTCCCTGCCCACTATGGTCCT No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014996_1152015000 -6 Left 1152014996 17:77744701-77744723 CCCACTATGGTCCTGGCCTCACC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014995_1152015000 -2 Left 1152014995 17:77744697-77744719 CCTGCCCACTATGGTCCTGGCCT No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014994_1152015000 -1 Left 1152014994 17:77744696-77744718 CCCTGCCCACTATGGTCCTGGCC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014997_1152015000 -7 Left 1152014997 17:77744702-77744724 CCACTATGGTCCTGGCCTCACCA No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data
1152014989_1152015000 21 Left 1152014989 17:77744674-77744696 CCCATGGAGATGCTCAGGCCTTC No data
Right 1152015000 17:77744718-77744740 CTCACCACTCACTGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152015000 Original CRISPR CTCACCACTCACTGCTCTCC TGG Intergenic
No off target data available for this crispr