ID: 1152015962

View in Genome Browser
Species Human (GRCh38)
Location 17:77750354-77750376
Sequence ACGTGGGCATAGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152015955_1152015962 0 Left 1152015955 17:77750331-77750353 CCCCGATGGCAAGGGGGGCACTT No data
Right 1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG No data
1152015957_1152015962 -2 Left 1152015957 17:77750333-77750355 CCGATGGCAAGGGGGGCACTTAC No data
Right 1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG No data
1152015956_1152015962 -1 Left 1152015956 17:77750332-77750354 CCCGATGGCAAGGGGGGCACTTA No data
Right 1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG No data
1152015954_1152015962 1 Left 1152015954 17:77750330-77750352 CCCCCGATGGCAAGGGGGGCACT No data
Right 1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152015962 Original CRISPR ACGTGGGCATAGATGGTGGC AGG Intergenic
No off target data available for this crispr