ID: 1152016928

View in Genome Browser
Species Human (GRCh38)
Location 17:77756895-77756917
Sequence GTCTCTCGCCTCTGTGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152016928_1152016936 23 Left 1152016928 17:77756895-77756917 CCGAGCCCACAGAGGCGAGAGAC No data
Right 1152016936 17:77756941-77756963 TCTGGCTGTTTATAGTTTGCAGG No data
1152016928_1152016934 -7 Left 1152016928 17:77756895-77756917 CCGAGCCCACAGAGGCGAGAGAC No data
Right 1152016934 17:77756911-77756933 GAGAGACAAGGGACATTGGCTGG No data
1152016928_1152016935 5 Left 1152016928 17:77756895-77756917 CCGAGCCCACAGAGGCGAGAGAC No data
Right 1152016935 17:77756923-77756945 ACATTGGCTGGAGAAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152016928 Original CRISPR GTCTCTCGCCTCTGTGGGCT CGG (reversed) Intergenic
No off target data available for this crispr