ID: 1152017549

View in Genome Browser
Species Human (GRCh38)
Location 17:77761535-77761557
Sequence AGAGCCCTGCATGGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152017532_1152017549 26 Left 1152017532 17:77761486-77761508 CCCTGCTTCCTCCCAAACTTCCT No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017533_1152017549 25 Left 1152017533 17:77761487-77761509 CCTGCTTCCTCCCAAACTTCCTT No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017534_1152017549 18 Left 1152017534 17:77761494-77761516 CCTCCCAAACTTCCTTCCAAATG No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017535_1152017549 15 Left 1152017535 17:77761497-77761519 CCCAAACTTCCTTCCAAATGAGC No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017541_1152017549 -8 Left 1152017541 17:77761520-77761542 CCTCCCGATGAGGACAGAGCCCT No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017537_1152017549 6 Left 1152017537 17:77761506-77761528 CCTTCCAAATGAGCCCTCCCGAT No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017538_1152017549 2 Left 1152017538 17:77761510-77761532 CCAAATGAGCCCTCCCGATGAGG No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017536_1152017549 14 Left 1152017536 17:77761498-77761520 CCAAACTTCCTTCCAAATGAGCC No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data
1152017540_1152017549 -7 Left 1152017540 17:77761519-77761541 CCCTCCCGATGAGGACAGAGCCC No data
Right 1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152017549 Original CRISPR AGAGCCCTGCATGGGCCTGG GGG Intergenic
No off target data available for this crispr