ID: 1152019940

View in Genome Browser
Species Human (GRCh38)
Location 17:77775688-77775710
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152019940_1152019949 13 Left 1152019940 17:77775688-77775710 CCCTCCACGGTCTCCCTCTGATG 0: 87
1: 19
2: 6
3: 18
4: 219
Right 1152019949 17:77775724-77775746 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1152019940_1152019945 -8 Left 1152019940 17:77775688-77775710 CCCTCCACGGTCTCCCTCTGATG 0: 87
1: 19
2: 6
3: 18
4: 219
Right 1152019945 17:77775703-77775725 CTCTGATGCCGAGCCAAAGCTGG 0: 142
1: 549
2: 481
3: 358
4: 290
1152019940_1152019946 -4 Left 1152019940 17:77775688-77775710 CCCTCCACGGTCTCCCTCTGATG 0: 87
1: 19
2: 6
3: 18
4: 219
Right 1152019946 17:77775707-77775729 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152019940 Original CRISPR CATCAGAGGGAGACCGTGGA GGG (reversed) Intergenic
900480798 1:2898222-2898244 CATCACAGGGGCACCATGGAGGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445441 1:64195556-64195578 CATGAGAGGGATTCCGTGTAAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079750685 11:24192325-24192347 CATGAGAGGGACTCCGTGGGAGG - Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081746010 11:45473095-45473117 CCACAGAGGGAGACCGTTGGTGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087020608 11:93598968-93598990 AATCAGAAGTATACCGTGGAAGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1112142964 13:96666269-96666291 CATCAGAGGGACCTGGTGGAAGG - Intronic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1118851429 14:69586867-69586889 CATCACAGAGAGTTCGTGGATGG + Intergenic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139876849 16:70153016-70153038 AATCAGATGAAGACCATGGAGGG + Intronic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG + Intergenic
1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092210 17:4455612-4455634 GCTCAGATGGACACCGTGGAGGG - Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1161727255 19:5936765-5936787 CATCAGTGGGTGACCGTCTATGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
931818000 2:65923445-65923467 CATTTCAGGAAGACCGTGGATGG + Intergenic
931930142 2:67122700-67122722 CATCAGAGAGATACCATGGCAGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG + Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974085572 4:57257039-57257061 TATCAGAGGTAGACGGTGGTAGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978398203 4:108305063-108305085 GAACAGATCGAGACCGTGGATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
979082525 4:116361134-116361156 CATCAGAGCCTGACCGTGGTGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
981818374 4:148857338-148857360 AGTCTGAGGGAGTCCGTGGAGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
985863658 5:2494800-2494822 CTTCTGAGGGACACCGTGAAAGG - Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
988336914 5:29919728-29919750 CATCTTAGGAAGACCATGGATGG - Intergenic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
998875812 5:146597945-146597967 CATTAGAGAGAGACCGCTGAAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000516496 5:162241502-162241524 CATCGGATGGAGGGCGTGGAGGG + Intergenic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003319633 6:5038862-5038884 CCGCGGAAGGAGACCGTGGAGGG + Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG + Intergenic
1021136805 7:16974843-16974865 CATGGGAGGGACACCGTGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1024356896 7:48422813-48422835 CATCAAAGGGGGATCGAGGAAGG + Intronic
1024598490 7:50960064-50960086 GATCAGAGGAGGACTGTGGAGGG - Intergenic
1024826922 7:53401114-53401136 CATGAGAGGGACTCGGTGGAAGG - Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1029090037 7:98040801-98040823 CATCATAGGGTTACCGTGGCTGG - Intergenic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035344384 7:158188605-158188627 CATCAGGGGGCGAGCGTGGCGGG - Intronic
1035734794 8:1880334-1880356 CGTAAGAGGGAGACAGTGAAAGG - Intronic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049414598 8:142489446-142489468 CATCAGAGTGTGCACGTGGACGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1058737065 9:107903567-107903589 CTTCAGAGATAGCCCGTGGACGG + Intergenic
1203548804 Un_KI270743v1:151842-151864 CTTCAGCGGGAGTCCGTTGAAGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1199555308 X:149101757-149101779 AATCAGAGAGAGAGCGTGGGAGG - Intergenic
1200897437 Y:8390615-8390637 TATCAGAAGGAGATCCTGGATGG + Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic