ID: 1152020960

View in Genome Browser
Species Human (GRCh38)
Location 17:77780021-77780043
Sequence CTCTCCCCCAGCCCCGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152020956_1152020960 -10 Left 1152020956 17:77780008-77780030 CCTCTGCTCGCTCCTCTCCCCCA No data
Right 1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG No data
1152020951_1152020960 19 Left 1152020951 17:77779979-77780001 CCAGCATGGCTTCGCCTGCCAGG No data
Right 1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG No data
1152020953_1152020960 5 Left 1152020953 17:77779993-77780015 CCTGCCAGGAGCCTTCCTCTGCT No data
Right 1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG No data
1152020955_1152020960 -6 Left 1152020955 17:77780004-77780026 CCTTCCTCTGCTCGCTCCTCTCC No data
Right 1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG No data
1152020954_1152020960 1 Left 1152020954 17:77779997-77780019 CCAGGAGCCTTCCTCTGCTCGCT No data
Right 1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152020960 Original CRISPR CTCTCCCCCAGCCCCGGGAC AGG Intergenic
No off target data available for this crispr