ID: 1152022975

View in Genome Browser
Species Human (GRCh38)
Location 17:77790747-77790769
Sequence CAGGCCCAGGTGAAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152022970_1152022975 -6 Left 1152022970 17:77790730-77790752 CCAGAGCAAGGAGGGGGCAGGCC No data
Right 1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG No data
1152022960_1152022975 30 Left 1152022960 17:77790694-77790716 CCAAAGGCAAGGAGAGCTCAGGG No data
Right 1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG No data
1152022968_1152022975 -2 Left 1152022968 17:77790726-77790748 CCAGCCAGAGCAAGGAGGGGGCA No data
Right 1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152022975 Original CRISPR CAGGCCCAGGTGAAGGTGTG GGG Intergenic
No off target data available for this crispr