ID: 1152026471

View in Genome Browser
Species Human (GRCh38)
Location 17:77812635-77812657
Sequence GAGCCCAACCCCATTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152026471_1152026479 10 Left 1152026471 17:77812635-77812657 CCAACACCAATGGGGTTGGGCTC No data
Right 1152026479 17:77812668-77812690 GGTGCCTATGGACTGTACCCTGG No data
1152026471_1152026478 -2 Left 1152026471 17:77812635-77812657 CCAACACCAATGGGGTTGGGCTC No data
Right 1152026478 17:77812656-77812678 TCTAGGGTGGGAGGTGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152026471 Original CRISPR GAGCCCAACCCCATTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr