ID: 1152027689

View in Genome Browser
Species Human (GRCh38)
Location 17:77822431-77822453
Sequence CACCAAATGCGGGCCTCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152027679_1152027689 16 Left 1152027679 17:77822392-77822414 CCCTGGAGGCGCACGCCTCCCCT No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027680_1152027689 15 Left 1152027680 17:77822393-77822415 CCTGGAGGCGCACGCCTCCCCTT No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027683_1152027689 -3 Left 1152027683 17:77822411-77822433 CCCTTAATCTCCTCTCTCCACAC No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027681_1152027689 1 Left 1152027681 17:77822407-77822429 CCTCCCCTTAATCTCCTCTCTCC No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027676_1152027689 27 Left 1152027676 17:77822381-77822403 CCCGGCCACTTCCCTGGAGGCGC No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027678_1152027689 22 Left 1152027678 17:77822386-77822408 CCACTTCCCTGGAGGCGCACGCC No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027677_1152027689 26 Left 1152027677 17:77822382-77822404 CCGGCCACTTCCCTGGAGGCGCA No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027684_1152027689 -4 Left 1152027684 17:77822412-77822434 CCTTAATCTCCTCTCTCCACACC No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data
1152027682_1152027689 -2 Left 1152027682 17:77822410-77822432 CCCCTTAATCTCCTCTCTCCACA No data
Right 1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152027689 Original CRISPR CACCAAATGCGGGCCTCGAG AGG Intergenic
No off target data available for this crispr