ID: 1152029831

View in Genome Browser
Species Human (GRCh38)
Location 17:77835038-77835060
Sequence TCCAGGCCTCCAGTTAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152029831_1152029838 -4 Left 1152029831 17:77835038-77835060 CCCCCCTTAACTGGAGGCCTGGA No data
Right 1152029838 17:77835057-77835079 TGGAGGAAGACAAGTGTGTCAGG No data
1152029831_1152029840 17 Left 1152029831 17:77835038-77835060 CCCCCCTTAACTGGAGGCCTGGA No data
Right 1152029840 17:77835078-77835100 GGGAAAATAGTGCAAGACCTTGG No data
1152029831_1152029839 -3 Left 1152029831 17:77835038-77835060 CCCCCCTTAACTGGAGGCCTGGA No data
Right 1152029839 17:77835058-77835080 GGAGGAAGACAAGTGTGTCAGGG No data
1152029831_1152029841 23 Left 1152029831 17:77835038-77835060 CCCCCCTTAACTGGAGGCCTGGA No data
Right 1152029841 17:77835084-77835106 ATAGTGCAAGACCTTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152029831 Original CRISPR TCCAGGCCTCCAGTTAAGGG GGG (reversed) Intergenic
No off target data available for this crispr