ID: 1152031248

View in Genome Browser
Species Human (GRCh38)
Location 17:77844902-77844924
Sequence TTGGAGAAGCATGGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152031248_1152031260 26 Left 1152031248 17:77844902-77844924 CCTGCCTCCCCATGCTTCTCCAA No data
Right 1152031260 17:77844951-77844973 ATTTGCTTGTCACCGGGGTCAGG No data
1152031248_1152031258 21 Left 1152031248 17:77844902-77844924 CCTGCCTCCCCATGCTTCTCCAA No data
Right 1152031258 17:77844946-77844968 TCGCCATTTGCTTGTCACCGGGG No data
1152031248_1152031257 20 Left 1152031248 17:77844902-77844924 CCTGCCTCCCCATGCTTCTCCAA No data
Right 1152031257 17:77844945-77844967 CTCGCCATTTGCTTGTCACCGGG No data
1152031248_1152031256 19 Left 1152031248 17:77844902-77844924 CCTGCCTCCCCATGCTTCTCCAA No data
Right 1152031256 17:77844944-77844966 ACTCGCCATTTGCTTGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152031248 Original CRISPR TTGGAGAAGCATGGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr