ID: 1152033045

View in Genome Browser
Species Human (GRCh38)
Location 17:77855480-77855502
Sequence TGTGATGCTGAAAGTCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152033045_1152033057 22 Left 1152033045 17:77855480-77855502 CCCTGTGGACTTTCAGCATCACA No data
Right 1152033057 17:77855525-77855547 GGTTTGCCTCTCCATCCTGGAGG No data
1152033045_1152033055 19 Left 1152033045 17:77855480-77855502 CCCTGTGGACTTTCAGCATCACA No data
Right 1152033055 17:77855522-77855544 CCCGGTTTGCCTCTCCATCCTGG No data
1152033045_1152033051 1 Left 1152033045 17:77855480-77855502 CCCTGTGGACTTTCAGCATCACA No data
Right 1152033051 17:77855504-77855526 GGGCAGGGACCACCTCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152033045 Original CRISPR TGTGATGCTGAAAGTCCACA GGG (reversed) Intergenic
No off target data available for this crispr