ID: 1152033681

View in Genome Browser
Species Human (GRCh38)
Location 17:77858777-77858799
Sequence CACTGGGGGTGAGTGCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152033681_1152033689 2 Left 1152033681 17:77858777-77858799 CCTGATGGCACTCACCCCCAGTG No data
Right 1152033689 17:77858802-77858824 GAGAGTGACACACAAATACACGG No data
1152033681_1152033690 3 Left 1152033681 17:77858777-77858799 CCTGATGGCACTCACCCCCAGTG No data
Right 1152033690 17:77858803-77858825 AGAGTGACACACAAATACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152033681 Original CRISPR CACTGGGGGTGAGTGCCATC AGG (reversed) Intergenic
No off target data available for this crispr