ID: 1152033681 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:77858777-77858799 |
| Sequence | CACTGGGGGTGAGTGCCATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152033681_1152033689 | 2 | Left | 1152033681 | 17:77858777-77858799 | CCTGATGGCACTCACCCCCAGTG | No data | ||
| Right | 1152033689 | 17:77858802-77858824 | GAGAGTGACACACAAATACACGG | No data | ||||
| 1152033681_1152033690 | 3 | Left | 1152033681 | 17:77858777-77858799 | CCTGATGGCACTCACCCCCAGTG | No data | ||
| Right | 1152033690 | 17:77858803-77858825 | AGAGTGACACACAAATACACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152033681 | Original CRISPR | CACTGGGGGTGAGTGCCATC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||